Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38296
Trapped Gene
Ap3b1 (ENSMUSG00000021686)
Vector Insertion
Chr 13: 95317849 - 95335559
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000301756 (Chr13:95317710..95317848 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACACTCATCGCTGCTCCAC Chr13:95317741..95317760 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000301756 (Chr13:95317710..95317848 +)
Downstram Exon
ENSMUSE00000391773 (Chr13:95335560..95336264 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACACTCATCGCTGCTCCAC Chr13:95317741..95317760 60.02 55 AACCAATCACGGTTTTCTCG Chr13:95335672..95335691 59.97 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000449147 Chr13:95128940..95129186 CAACAGTTTCGCCTACAACG Chr13:95129067..95129086 59.39 50
upstream ENSMUSE00000301935 Chr13:95160747..95160822 TGCTGGAGAGCAACAAAGATT Chr13:95160767..95160787 60.01 42.86
upstream ENSMUSE00000472126 Chr13:95164674..95164748 TGTGGCCAGTAAAAACATCG Chr13:95164727..95164746 59.58 45
upstream ENSMUSE00000301919 Chr13:95173293..95173388 GACCTGGCTCTTCTGTCCAT Chr13:95173344..95173363 59.26 55
upstream ENSMUSE00000301912 Chr13:95173902..95174062 TATCGTGCCTGTCATGATGC Chr13:95173964..95173983 60.66 50
upstream ENSMUSE00000301904 Chr13:95178732..95178798 CCCGAGCAGAAGGAGATGTT Chr13:95178739..95178758 61.69 55
upstream ENSMUSE00000301899 Chr13:95187916..95188098 AGAAGTGTGCCCGGATAGAA Chr13:95187948..95187967 59.69 50
upstream ENSMUSE00000301893 Chr13:95210210..95210368 AGAGCAGCAGGAAGAAGTCG Chr13:95210277..95210296 59.89 55
upstream ENSMUSE00000301887 Chr13:95213874..95213971 ATTGGCACATCTCACCCAAG Chr13:95213899..95213918 60.92 50
upstream ENSMUSE00000301880 Chr13:95215877..95215931 No primer for this exon
upstream ENSMUSE00000301875 Chr13:95216021..95216092 No primer for this exon
upstream ENSMUSE00000301869 Chr13:95218408..95218470 ACTTGGCAAATGAAGCCAAC Chr13:95218424..95218443 60.12 45
upstream ENSMUSE00000301862 Chr13:95220908..95221040 ATTAGCGAGGTCACCGACAC Chr13:95220980..95220999 60.14 55
upstream ENSMUSE00000301857 Chr13:95225351..95225460 GGCCAAGCTCTTGGACAGTA Chr13:95225436..95225455 60.4 55
upstream ENSMUSE00000301849 Chr13:95232351..95232527 CCTGTGGCTAGAGCAAGCAT Chr13:95232354..95232373 60.56 55
upstream ENSMUSE00000301843 Chr13:95241631..95241817 GTTCCGAACGAGAAGAGTGG Chr13:95241724..95241743 59.84 55
upstream ENSMUSE00000120009 Chr13:95242754..95242884 TTCCAGCTTGGCACCTTATC Chr13:95242765..95242784 60.21 50
upstream ENSMUSE00000120013 Chr13:95246921..95247083 TGAGGATGAGAACCCCTCTG Chr13:95247046..95247065 60.19 55
upstream ENSMUSE00000120019 Chr13:95249682..95249829 AGCAGTGAGGACTCGTCCAG Chr13:95249726..95249745 60.61 60
upstream ENSMUSE00000120017 Chr13:95253168..95253315 GCTTCTGAATCGTCCAGTGAG Chr13:95253208..95253228 60.01 52.38
upstream ENSMUSE00000120010 Chr13:95263624..95263696 AAACCCCAGCAAGAAAGACA Chr13:95263636..95263655 59.71 45
upstream ENSMUSE00000120011 Chr13:95271873..95271979 AACCCAGTATCCACCCCAGT Chr13:95271875..95271894 60.49 55
upstream ENSMUSE00000120012 Chr13:95298120..95298351 TCAGTACGCCTGTCTTCGTG Chr13:95298121..95298140 60.05 55
upstream ENSMUSE00000120016 Chr13:95301937..95302021 TAAGGGGTCCGTGACTGTCT Chr13:95301950..95301969 59.57 55
upstream ENSMUSE00000120014 Chr13:95312734..95312831 CAAGGATGACTGCTTCAACG Chr13:95312737..95312756 59.44 50
upstream ENSMUSE00000301756 Chr13:95317710..95317848 TACACTCATCGCTGCTCCAC Chr13:95317741..95317760 60.02 55

*** Putative Vector Insertion (Chr 13: 95317849 - 95335559) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391773 Chr13:95335560..95336264 AACCAATCACGGTTTTCTCG Chr13:95335672..95335691 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCTTCCAGCCAAGATAAC Chr13:95323822..95323842 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGAAGAGCAGGACTGAGG Chr13:95332809..95332829 58.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021686