Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38300
Trapped Gene
Dlgap1 (ENSMUSG00000003279)
Vector Insertion
Chr 17: 70555686 - 70657386
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692665 (Chr17:70555577..70555685 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692665 (Chr17:70555577..70555685 +)
Downstram Exon
ENSMUSE00000692663 (Chr17:70657387..70657510 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411615 Chr17:70318586..70319010 No primer for this exon
upstream ENSMUSE00000692672 Chr17:70427602..70427763 No primer for this exon
upstream ENSMUSE00000692665 Chr17:70555577..70555685 No primer for this exon

*** Putative Vector Insertion (Chr 17: 70555686 - 70657386) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692663 Chr17:70657387..70657510 No primer for this exon
downstream ENSMUSE00000692659 Chr17:70774136..70774228 No primer for this exon
downstream ENSMUSE00000369734 Chr17:70865294..70866336 No primer for this exon
downstream ENSMUSE00000692632 Chr17:70911127..70911211 No primer for this exon
downstream ENSMUSE00000422422 Chr17:70942507..70942721 No primer for this exon
downstream ENSMUSE00000422417 Chr17:71006794..71006971 No primer for this exon
downstream ENSMUSE00000354741 Chr17:71011909..71012149 No primer for this exon
downstream ENSMUSE00000399544 Chr17:71067536..71067565 No primer for this exon
downstream ENSMUSE00000361534 Chr17:71110415..71110785 No primer for this exon
downstream ENSMUSE00000407470 Chr17:71115338..71115429 No primer for this exon
downstream ENSMUSE00000348253 Chr17:71136128..71136549 No primer for this exon
downstream ENSMUSE00000353149 Chr17:71158528..71158619 No primer for this exon
downstream ENSMUSE00000137561 Chr17:71164534..71164686 No primer for this exon
downstream ENSMUSE00000692631 Chr17:71164534..71165433 No primer for this exon
downstream ENSMUSE00000657023 Chr17:71167365..71169064 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACACCTTAATCGCCTTGCAG Chr17:70609731..70609751 60.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGGTTTTTCCGTGACTGG Chr17:70609726..70609746 60.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003279