Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38306
Trapped Gene
Atp2a2 (ENSMUSG00000029467)
Vector Insertion
Chr 5: 122909984 - 122910986
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189140 (Chr5:122910650..122910985 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTAAATGCCCGCTGTTTTG Chr5:122910721..122910740 60.61 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189140 (Chr5:122910650..122910985 -)
Downstram Exon
ENSMUSE00000537827 (Chr5:122909985..122910205 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTAAATGCCCGCTGTTTTG Chr5:122910721..122910740 60.61 45 GCCACAATGGTGGAGAAGTT Chr5:122910050..122910069 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000537853 Chr5:122951577..122952183 TGGAGAACGCTCACACAAAG Chr5:122951674..122951693 60.03 50
upstream ENSMUSE00000649906 Chr5:122950940..122950957 No primer for this exon
upstream ENSMUSE00000330577 Chr5:122950740..122950822 AAACCTTGCTGGAACTTGTGA Chr5:122950799..122950819 59.77 42.86
upstream ENSMUSE00000189133 Chr5:122941690..122941794 AGCCTTTGTAGAGCCGTTTG Chr5:122941737..122941756 59.52 50
upstream ENSMUSE00000189144 Chr5:122939247..122939385 TGGGCAAAGTGTATCGACAG Chr5:122939314..122939333 59.72 50
upstream ENSMUSE00000189122 Chr5:122923219..122923299 GGTGACAAAGTTCCTGCTGA Chr5:122923278..122923297 58.85 50
upstream ENSMUSE00000189137 Chr5:122921177..122921262 TCTGTCTCCGTCATCAAGCA Chr5:122921238..122921257 60.56 50
upstream ENSMUSE00000468831 Chr5:122919359..122919823 GGAACTCGTAGGATGGCAAA Chr5:122919471..122919490 60.07 50
upstream ENSMUSE00000189143 Chr5:122917716..122917804 No primer for this exon
upstream ENSMUSE00000189138 Chr5:122916837..122916939 TAGCCACCATCTGTGCTCTG Chr5:122916867..122916886 60.01 55
upstream ENSMUSE00000330489 Chr5:122915959..122916090 GGAGAAGCTACCGAGACTGC Chr5:122916047..122916066 59.19 60
upstream ENSMUSE00000330474 Chr5:122911872..122911994 TGTACCCCAAACAAGCCAAG Chr5:122911903..122911922 60.91 50
upstream ENSMUSE00000330462 Chr5:122911575..122911793 CCACTCATGACAACCCACTG Chr5:122911626..122911645 60 55
upstream ENSMUSE00000189140 Chr5:122910650..122910985 CTTAAATGCCCGCTGTTTTG Chr5:122910721..122910740 60.61 45
upstream ENSMUSE00000537827 Chr5:122909985..122910205 AGATGGTCCTGGCAGATGAC Chr5:122910092..122910111 60.08 55

*** Putative Vector Insertion (Chr 5: 122909984 - 122910986) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189126 Chr5:122909457..122909659 TGTCACCAGATTGACCCAGA Chr5:122909562..122909581 60.09 50
downstream ENSMUSE00000189130 Chr5:122908457..122908542 No primer for this exon
downstream ENSMUSE00000189121 Chr5:122908097..122908230 CCATCGAAGTCTGGGTTGTC Chr5:122908165..122908184 60.51 55
downstream ENSMUSE00000189134 Chr5:122907521..122907638 GCAAAGGTTCCACGTAGAGG Chr5:122907501..122907520 59.73 55
downstream ENSMUSE00000649903 Chr5:122907312..122907435 CAGGCAAGGAGATTTTCAGC Chr5:122907347..122907366 59.96 50
downstream ENSMUSE00000688705 Chr5:122906969..122906979 No primer for this exon
downstream ENSMUSE00000330415 Chr5:122905902..122907435 AGGCAAACCTCTCGTGAAGA Chr5:122906514..122906533 59.99 50
downstream ENSMUSE00000428869 Chr5:122903531..122904313 CCTTCTCGCAGCAAAGAAAC Chr5:122904014..122904033 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr5:122910916..122910936 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGACGTGACTGGGAAAAC Chr5:122910920..122910940 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029467