Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3831
Trapped Gene
Atp2a2 (ENSMUSG00000029467)
Vector Insertion
Chr 5: 122939386 - 122941689
Public Clones AX0481 (sanger) W087F03 (ggtc) (ggtc) W072E08 (ggtc) F027C03 (ggtc)
Private Clones OST413744 (lexicon) OST57911 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189133 (Chr5:122941690..122941794 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTTTGTAGAGCCGTTTG Chr5:122941737..122941756 59.52 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189133 (Chr5:122941690..122941794 -)
Downstram Exon
ENSMUSE00000189144 (Chr5:122939247..122939385 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTTTGTAGAGCCGTTTG Chr5:122941737..122941756 59.52 50 TGTCGATACACTTTGCCCATT Chr5:122939293..122939313 60.38 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000537853 Chr5:122951577..122952183 TGGAGAACGCTCACACAAAG Chr5:122951674..122951693 60.03 50
upstream ENSMUSE00000649906 Chr5:122950940..122950957 No primer for this exon
upstream ENSMUSE00000330577 Chr5:122950740..122950822 AAACCTTGCTGGAACTTGTGA Chr5:122950799..122950819 59.77 42.86
upstream ENSMUSE00000189133 Chr5:122941690..122941794 AGCCTTTGTAGAGCCGTTTG Chr5:122941737..122941756 59.52 50

*** Putative Vector Insertion (Chr 5: 122939386 - 122941689) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189144 Chr5:122939247..122939385 TGTCGATACACTTTGCCCATT Chr5:122939293..122939313 60.38 42.86
downstream ENSMUSE00000189122 Chr5:122923219..122923299 TCAGCAGGAACTTTGTCACC Chr5:122923256..122923275 58.85 50
downstream ENSMUSE00000189137 Chr5:122921177..122921262 TGCTTGATGACGGAGACAGA Chr5:122921216..122921235 60.56 50
downstream ENSMUSE00000468831 Chr5:122919359..122919823 GGCAGACTTCGAACGATAGC Chr5:122919422..122919441 59.99 55
downstream ENSMUSE00000189143 Chr5:122917716..122917804 TCCAATTGGTGCATATGTGG Chr5:122917699..122917718 60.2 45
downstream ENSMUSE00000189138 Chr5:122916837..122916939 CCCGTCATACTGATGGCACT Chr5:122916875..122916894 60.94 55
downstream ENSMUSE00000330489 Chr5:122915959..122916090 GCGTTTGCACGCTCTATTTT Chr5:122915947..122915966 60.4 45
downstream ENSMUSE00000330474 Chr5:122911872..122911994 TGGCTTGTTTGGGGTACAAT Chr5:122911883..122911902 60.23 45
downstream ENSMUSE00000330462 Chr5:122911575..122911793 CAGTGGGTTGTCATGAGTGG Chr5:122911604..122911623 60 55
downstream ENSMUSE00000189140 Chr5:122910650..122910985 GGAAGGTTCAACTCGAGCAA Chr5:122910682..122910701 60.38 50
downstream ENSMUSE00000537827 Chr5:122909985..122910205 GCCACAATGGTGGAGAAGTT Chr5:122910050..122910069 59.97 50
downstream ENSMUSE00000189126 Chr5:122909457..122909659 TGTCACCAGATTGACCCAGA Chr5:122909562..122909581 60.09 50
downstream ENSMUSE00000189130 Chr5:122908457..122908542 No primer for this exon
downstream ENSMUSE00000189121 Chr5:122908097..122908230 CCATCGAAGTCTGGGTTGTC Chr5:122908165..122908184 60.51 55
downstream ENSMUSE00000189134 Chr5:122907521..122907638 GCAAAGGTTCCACGTAGAGG Chr5:122907501..122907520 59.73 55
downstream ENSMUSE00000649903 Chr5:122907312..122907435 CAGGCAAGGAGATTTTCAGC Chr5:122907347..122907366 59.96 50
downstream ENSMUSE00000688705 Chr5:122906969..122906979 No primer for this exon
downstream ENSMUSE00000330415 Chr5:122905902..122907435 AGGCAAACCTCTCGTGAAGA Chr5:122906514..122906533 59.99 50
downstream ENSMUSE00000428869 Chr5:122903531..122904313 CCTTCTCGCAGCAAAGAAAC Chr5:122904014..122904033 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGGCAGGTAAGCAGAACA Chr5:122941676..122941696 60.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGGCAGGTAAGCAGAACA Chr5:122941676..122941696 60.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCGAGGAAGGGGAAGAAAC Chr5:122941761..122941781 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCCTTTGTAGCGTGACTGG Chr5:122941735..122941755 60.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029467