Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38338
Trapped Gene
AC126430.3 (ENSMUSG00000075259)
Vector Insertion
Chr 10: 31466307 - 31671126
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666498 (Chr10:31670808..31671125 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGACGTCTGTGACACCTG Chr10:31671032..31671051 60.21 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666498 (Chr10:31670808..31671125 -)
Downstram Exon
ENSMUSE00000576754 (Chr10:31466308..31466368 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGACGTCTGTGACACCTG Chr10:31671032..31671051 60.21 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666499 Chr10:31671289..31671294 No primer for this exon
upstream ENSMUSE00000666501 Chr10:31670925..31671125 GGTGACGTCTGTGACACCTG Chr10:31671032..31671051 60.21 60
upstream ENSMUSE00000666498 Chr10:31670808..31671125 GGTGACGTCTGTGACACCTG Chr10:31671032..31671051 60.21 60
upstream ENSMUSE00000576754 Chr10:31466308..31466368 GGGCTTCATCTATGCCTGTT Chr10:31466344..31466363 59.15 50

*** Putative Vector Insertion (Chr 10: 31466307 - 31671126) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000576751 Chr10:31414138..31414219 GTCTTCTGAGGCCCTTGGTA Chr10:31414146..31414165 59.28 55
downstream ENSMUSE00000666500 Chr10:31409148..31411493 AGGGTTCCAAACTTGTGTGC Chr10:31411052..31411071 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTCTTTGCCTCCAGCAAC Chr10:31599095..31599115 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTCTTTGCCTCCAGCAAC Chr10:31599095..31599115 59.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075259