Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38345
Trapped Gene
Rnf185 (ENSMUSG00000020448)
Vector Insertion
Chr 11: 3319864 - 3325340
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104747 (Chr11:3325285..3325339 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104747 (Chr11:3325285..3325339 -)
Downstram Exon
ENSMUSE00000104743 (Chr11:3319865..3319982 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416051 Chr11:3352212..3352309 No primer for this exon
upstream ENSMUSE00000595379 Chr11:3352212..3352366 No primer for this exon
upstream ENSMUSE00000416041 Chr11:3338208..3338326 No primer for this exon
upstream ENSMUSE00000682440 Chr11:3338208..3338270 No primer for this exon
upstream ENSMUSE00000581549 Chr11:3332403..3332623 No primer for this exon
upstream ENSMUSE00000581554 Chr11:3332403..3332623 No primer for this exon
upstream ENSMUSE00000656344 Chr11:3328887..3328905 No primer for this exon
upstream ENSMUSE00000104745 Chr11:3326569..3326681 No primer for this exon
upstream ENSMUSE00000104747 Chr11:3325285..3325339 No primer for this exon
upstream ENSMUSE00000104743 Chr11:3319865..3319982 No primer for this exon

*** Putative Vector Insertion (Chr 11: 3319864 - 3325340) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000332999 Chr11:3315986..3318090 No primer for this exon
downstream ENSMUSE00000706248 Chr11:3315985..3318090 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTCCTCCTCGTCCTCAAG Chr11:3325312..3325332 58.97 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTCCTCCTCGTCCTCAAG Chr11:3325312..3325332 58.97 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020448