Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38351
Trapped Gene
AC195265.1-201 (ENSMUSG00000072736)
Vector Insertion
Chr 14: 7243964 - 7423175
Public Clones (sanger) (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000650976 (Chr14:7422993..7423174 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000650976 (Chr14:7422993..7423174 -)
Downstram Exon
ENSMUSE00000692924 (Chr14:7243965..7244127 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650976 Chr14:7422993..7423174 No primer for this exon
upstream ENSMUSE00000692924 Chr14:7243965..7244127 No primer for this exon

*** Putative Vector Insertion (Chr 14: 7243964 - 7423175) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692923 Chr14:7242883..7243014 No primer for this exon
downstream ENSMUSE00000692922 Chr14:7242137..7242206 No primer for this exon
downstream ENSMUSE00000692920 Chr14:7242025..7242134 No primer for this exon
downstream ENSMUSE00000692919 Chr14:7241753..7241759 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTTCAAAGTCTTGTCAGCAG Chr14:7258183..7258205 59.66 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTCAAAGTCTTGTCAGCAG Chr14:7258183..7258205 59.66 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072736