Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38363
Trapped Gene
Smarca1 (ENSMUSG00000031099)
Vector Insertion
Chr X: 45214455 - 45227401
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000322613 (ChrX:45227332..45227400 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000322613 (ChrX:45227332..45227400 -)
Downstram Exon
ENSMUSE00000322606 (ChrX:45214456..45214565 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTATCCGGCGTAACAAAAATG ChrX:45214513..45214533 59.85 38.1

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701504 ChrX:45246041..45246151 TTTGTGCAAGAAGGGGAGAG ChrX:45246050..45246069 60.37 50
upstream ENSMUSE00000701506 ChrX:45245463..45245650 GCCACAGTCGTGGTTGTAGA ChrX:45245500..45245519 59.75 55
upstream ENSMUSE00000701522 ChrX:45245463..45245573 GCCACAGTCGTGGTTGTAGA ChrX:45245500..45245519 59.75 55
upstream ENSMUSE00000392493 ChrX:45245403..45245729 AGAAGGGCGAGAAGAAGGAG ChrX:45245403..45245422 60.09 55
upstream ENSMUSE00000488379 ChrX:45245403..45245696 AGAAGGGCGAGAAGAAGGAG ChrX:45245403..45245422 60.09 55
upstream ENSMUSE00000701503 ChrX:45245403..45245626 AGAAGGGCGAGAAGAAGGAG ChrX:45245403..45245422 60.09 55
upstream ENSMUSE00000701502 ChrX:45242984..45243058 No primer for this exon
upstream ENSMUSE00000656045 ChrX:45240289..45240375 TGCTGCTAAAGCTTCCAAATC ChrX:45240326..45240346 59.62 42.86
upstream ENSMUSE00000322668 ChrX:45240274..45240375 TTGCTGCTAAAGCTTCCAAA ChrX:45240328..45240347 58.84 40
upstream ENSMUSE00000206443 ChrX:45237214..45237380 AGCTTGATTTCCGTTGGAGA ChrX:45237214..45237233 59.81 45
upstream ENSMUSE00000206446 ChrX:45236753..45236853 AGATTCGAGGTCTCCCCTTC ChrX:45236755..45236774 59.64 55
upstream ENSMUSE00000555599 ChrX:45236525..45236625 AGGAGGACCGCTGAGAGATT ChrX:45236599..45236618 60.36 55
upstream ENSMUSE00000206459 ChrX:45232623..45232802 GCCTTGCTTGGTTACCTGAA ChrX:45232756..45232775 60.25 50
upstream ENSMUSE00000555585 ChrX:45229562..45229717 GGGATGTTTGCGTGACTTCT ChrX:45229661..45229680 60.12 50
upstream ENSMUSE00000322619 ChrX:45228341..45228472 CTGGGACACCTTTGCAGAAT ChrX:45228404..45228423 60.11 50
upstream ENSMUSE00000322613 ChrX:45227332..45227400 No primer for this exon
upstream ENSMUSE00000322606 ChrX:45214456..45214565 TGTTACGCCGGATAAAAACC ChrX:45214530..45214549 59.83 45

*** Putative Vector Insertion (Chr X: 45214455 - 45227401) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000555575 ChrX:45213598..45213824 CAAGAGTCGCATCTTGTCCA ChrX:45213730..45213749 59.98 50
downstream ENSMUSE00000322594 ChrX:45211433..45211554 GGTTTGTCCATCCAGTCGAG ChrX:45211429..45211448 60.51 55
downstream ENSMUSE00000701517 ChrX:45208755..45208790 TTGACCCAATAATTCCACTTCC ChrX:45208736..45208757 60.06 40.91
downstream ENSMUSE00000322586 ChrX:45207743..45207895 TGCTGCTATTTGGAGCATTG ChrX:45207837..45207856 59.98 45
downstream ENSMUSE00000322580 ChrX:45205772..45205904 TTCTTCTGACCAATGCGATG ChrX:45205854..45205873 59.8 45
downstream ENSMUSE00000322575 ChrX:45204822..45204970 TGTAGCTCCATGACGGATCA ChrX:45204875..45204894 60.22 50
downstream ENSMUSE00000322571 ChrX:45203093..45203212 TTTTCTGCATGCGTTCATTC ChrX:45203160..45203179 59.82 40
downstream ENSMUSE00000370053 ChrX:45195086..45195196 GGCTTTGCGTTCTCGTTTAG ChrX:45195127..45195146 60.02 50
downstream ENSMUSE00000355792 ChrX:45194714..45194827 TCCTTTTCCAGGAGCTCAAA ChrX:45194726..45194745 59.93 45
downstream ENSMUSE00000206453 ChrX:45182036..45182158 GGTTGGGGATCTCAGGATTT ChrX:45182109..45182128 60.13 50
downstream ENSMUSE00000206450 ChrX:45179670..45179802 CCCTCCACCTCTCGAGCTAT ChrX:45179680..45179699 60.75 60
downstream ENSMUSE00000206449 ChrX:45176867..45176985 TCCTTCGCTGAATTCTTGCT ChrX:45176874..45176893 60.1 45
downstream ENSMUSE00000555550 ChrX:45176542..45176754 GGGAGCATTCCGTACACACT ChrX:45176562..45176581 60 55
downstream ENSMUSE00000656044 ChrX:45164335..45164445 GGAGTTTTAGTTGCCCGTTTC ChrX:45164317..45164337 59.99 47.62
downstream ENSMUSE00000514599 ChrX:45164304..45164445 GGAGTTTTAGTTGCCCGTTTC ChrX:45164317..45164337 59.99 47.62
downstream ENSMUSE00000555546 ChrX:45162810..45164445 TTTCCCCATTAGCACCTCTG ChrX:45163671..45163690 60.07 50
downstream ENSMUSE00000701505 ChrX:45162810..45163366 AGCAGCGGCATAGAAAACAT ChrX:45162889..45162908 59.87 45
downstream ENSMUSE00000322515 ChrX:45162547..45163297 AGCAGCGGCATAGAAAACAT ChrX:45162889..45162908 59.87 45
downstream ENSMUSE00000656043 ChrX:45162547..45163297 AGCAGCGGCATAGAAAACAT ChrX:45162889..45162908 59.87 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCCTCCATAGGACTTTGA ChrX:45218391..45218411 58.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCCTCCATAGGACTTTGA ChrX:45218391..45218411 58.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031099