Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38365
Trapped Gene
Prkcd (ENSMUSG00000021948)
Vector Insertion
Chr 14: 31415844 - 31417394
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242270 (Chr14:31417293..31417393 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCCTTGAACCAAGTGAC Chr14:31417297..31417316 59.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242270 (Chr14:31417293..31417393 -)
Downstram Exon
ENSMUSE00000690812 (Chr14:31415845..31416013 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCCTTGAACCAAGTGAC Chr14:31417297..31417316 59.7 55 CTGCTGGGGAATGATAGCTT Chr14:31415855..31415874 59.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690842 Chr14:31439166..31439396 CCGGATCAGACTTGTGCCTA Chr14:31439255..31439274 61.2 55
upstream ENSMUSE00000562907 Chr14:31423374..31423498 AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50
upstream ENSMUSE00000690789 Chr14:31423374..31423488 AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50
upstream ENSMUSE00000715335 Chr14:31423374..31423496 AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50
upstream ENSMUSE00000719030 Chr14:31423374..31423496 AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50
upstream ENSMUSE00000122412 Chr14:31422288..31422487 AGGCCGTGTTATCCAGATTG Chr14:31422389..31422408 59.96 50
upstream ENSMUSE00000690780 Chr14:31422288..31422487 AGGCCGTGTTATCCAGATTG Chr14:31422389..31422408 59.96 50
upstream ENSMUSE00000242306 Chr14:31420794..31420854 TGCAGTATTTCCTGGAGGATG Chr14:31420797..31420817 60.08 47.62
upstream ENSMUSE00000690778 Chr14:31420794..31420854 TGCAGTATTTCCTGGAGGATG Chr14:31420797..31420817 60.08 47.62
upstream ENSMUSE00000690786 Chr14:31420794..31421008 CTGGCCCTCACTGATTTGTC Chr14:31420876..31420895 60.66 55
upstream ENSMUSE00000242298 Chr14:31420474..31420636 CACGAGTTTATCGCCACCTT Chr14:31420519..31420538 60.13 50
upstream ENSMUSE00000242294 Chr14:31420349..31420380 GCCTCAACAAGCAAGGCTAC Chr14:31420359..31420378 60.02 55
upstream ENSMUSE00000242286 Chr14:31419002..31419087 No primer for this exon
upstream ENSMUSE00000242277 Chr14:31418626..31418755 AGAACGCTTCAACATCGACA Chr14:31418728..31418747 59.44 45
upstream ENSMUSE00000242270 Chr14:31417293..31417393 GAGGCCTTGAACCAAGTGAC Chr14:31417297..31417316 59.7 55
upstream ENSMUSE00000361748 Chr14:31415923..31416013 GCCAGAAGTCTCTGGGAGTG Chr14:31415932..31415951 59.99 60
upstream ENSMUSE00000690812 Chr14:31415845..31416013 AAAGCTATCATTCCCCAGCA Chr14:31415878..31415897 59.67 45

*** Putative Vector Insertion (Chr 14: 31415844 - 31417394) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000242250 Chr14:31415500..31415600 CCTCCCAGATCTTGCCATAG Chr14:31415546..31415565 59.65 55
downstream ENSMUSE00000562921 Chr14:31415219..31415392 CAACACCACGTCCTTCTTCA Chr14:31415299..31415318 59.72 50
downstream ENSMUSE00000122370 Chr14:31414946..31415037 TCCATCACGAAGAACAGGTG Chr14:31414993..31415012 59.68 50
downstream ENSMUSE00000122365 Chr14:31414355..31414417 AACTGCAGTCCGCAGATGAT Chr14:31414360..31414379 60.83 50
downstream ENSMUSE00000562915 Chr14:31412796..31412934 TCACATTGTCCAGCTTGAGG Chr14:31412890..31412909 59.83 50
downstream ENSMUSE00000562912 Chr14:31412504..31412692 GTGATCCAACGGGGATAGTG Chr14:31412510..31412529 60.19 55
downstream ENSMUSE00000122362 Chr14:31411904..31412032 TCAGGGTCCCTCTCGAATAG Chr14:31411991..31412010 59.23 55
downstream ENSMUSE00000690777 Chr14:31411698..31411814 ACATACACAGCATGCCAGGA Chr14:31411753..31411772 60.14 50
downstream ENSMUSE00000690774 Chr14:31411593..31411814 GCTACATTCCCCAGCTCAAG Chr14:31411653..31411672 59.84 55
downstream ENSMUSE00000690784 Chr14:31408780..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50
downstream ENSMUSE00000690785 Chr14:31408778..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50
downstream ENSMUSE00000393493 Chr14:31408555..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50
downstream ENSMUSE00000690790 Chr14:31408545..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50
downstream ENSMUSE00000690788 Chr14:31408544..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACCTGCCTCTGATTCTTG Chr14:31417395..31417415 59.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACCTGCCTCTGATTCTTG Chr14:31417395..31417415 59.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021948