Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38378
Trapped Gene
Ube1y1 (ENSMUSG00000069053)
Vector Insertion
Chr Y: 170707 - 178410
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568678 (ChrY:170618..170706 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568678 (ChrY:170618..170706 +)
Downstram Exon
ENSMUSE00000568677 (ChrY:178411..178503 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704582 ChrY:155092..155193 No primer for this exon
upstream ENSMUSE00000704571 ChrY:155156..155257 No primer for this exon
upstream ENSMUSE00000568713 ChrY:157264..157380 No primer for this exon
upstream ENSMUSE00000568711 ChrY:157495..157550 No primer for this exon
upstream ENSMUSE00000568709 ChrY:157635..157803 No primer for this exon
upstream ENSMUSE00000568707 ChrY:157893..158027 No primer for this exon
upstream ENSMUSE00000568706 ChrY:158589..158695 No primer for this exon
upstream ENSMUSE00000568705 ChrY:158902..158992 No primer for this exon
upstream ENSMUSE00000568703 ChrY:159587..159719 No primer for this exon
upstream ENSMUSE00000568701 ChrY:161891..161988 No primer for this exon
upstream ENSMUSE00000568699 ChrY:162085..162231 No primer for this exon
upstream ENSMUSE00000568695 ChrY:162342..162518 No primer for this exon
upstream ENSMUSE00000568694 ChrY:162621..162725 No primer for this exon
upstream ENSMUSE00000568691 ChrY:162814..162894 No primer for this exon
upstream ENSMUSE00000568689 ChrY:163205..163360 No primer for this exon
upstream ENSMUSE00000568687 ChrY:165209..165374 No primer for this exon
upstream ENSMUSE00000568686 ChrY:165584..165780 No primer for this exon
upstream ENSMUSE00000568685 ChrY:167702..167766 No primer for this exon
upstream ENSMUSE00000568683 ChrY:168018..168213 No primer for this exon
upstream ENSMUSE00000568680 ChrY:168767..168841 No primer for this exon
upstream ENSMUSE00000568679 ChrY:168947..169139 No primer for this exon
upstream ENSMUSE00000568678 ChrY:170618..170706 No primer for this exon

*** Putative Vector Insertion (Chr Y: 170707 - 178410) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568677 ChrY:178411..178503 No primer for this exon
downstream ENSMUSE00000568676 ChrY:178623..178814 No primer for this exon
downstream ENSMUSE00000568675 ChrY:179367..179468 No primer for this exon
downstream ENSMUSE00000568674 ChrY:179577..179677 No primer for this exon
downstream ENSMUSE00000647338 ChrY:179830..180125 No primer for this exon
downstream ENSMUSE00000656575 ChrY:179830..180667 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTATTTGGTGTGGGGAAG ChrY:170705..170726 60.1 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTATTTGGTGTGGGGAAG ChrY:170705..170726 60.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069053