Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38387
Trapped Gene
Dph3 (ENSMUSG00000021905)
Vector Insertion
Chr 14: 32898092 - 32898796
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000121880 (Chr14:32898596..32898795 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGATAACTTTGCCATCACC Chr14:32898599..32898618 59.25 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000121880 (Chr14:32898596..32898795 -)
Downstram Exon
ENSMUSE00000517748 (Chr14:32898093..32898167 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGATAACTTTGCCATCACC Chr14:32898599..32898618 59.25 50 GTGGCCACATCTTCTCCATT Chr14:32898114..32898133 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000121880 Chr14:32898596..32898795 GGGATAACTTTGCCATCACC Chr14:32898599..32898618 59.25 50
upstream ENSMUSE00000446599 Chr14:32898596..32898851 GGGATAACTTTGCCATCACC Chr14:32898599..32898618 59.25 50
upstream ENSMUSE00000517748 Chr14:32898093..32898167 CGTGTCCTAGCTGCTCACTC Chr14:32898117..32898136 58.78 60

*** Putative Vector Insertion (Chr 14: 32898092 - 32898796) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000690104 Chr14:32897882..32898167 ACACTCTTCCGCCCTTTTCT Chr14:32897983..32898002 60.25 50
downstream ENSMUSE00000510619 Chr14:32896355..32896432 CCTTGTTGGTTGAAGGTGCT Chr14:32896362..32896381 60.15 50
downstream ENSMUSE00000383326 Chr14:32893752..32894455 TCTGGAAACGTCTGGGATTC Chr14:32894057..32894076 60.05 50
downstream ENSMUSE00000513766 Chr14:32893748..32896432 GGCAAGTTAGCAGGCTTCAC Chr14:32895418..32895437 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCGGAAGTGACTGTTCCT Chr14:32898784..32898804 59.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCGGAAGTGACTGTTCCT Chr14:32898784..32898804 59.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021905