Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38391
Trapped Gene
Kri1 (ENSMUSG00000035047)
Vector Insertion
Chr 9: 21089684 - 21091129
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000294134 (Chr9:21091023..21091128 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCCCAGCAGGAGAGAGAC Chr9:21091102..21091121 60.76 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000294134 (Chr9:21091023..21091128 -)
Downstram Exon
ENSMUSE00000294109 (Chr9:21089685..21089811 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCCCAGCAGGAGAGAGAC Chr9:21091102..21091121 60.76 60 CTTCAGGTACATGGGCTGCT Chr9:21089698..21089717 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000350261 Chr9:21092304..21092405 CTGGGTGCCTAAAGGTGAAC Chr9:21092359..21092378 59.59 55
upstream ENSMUSE00000294155 Chr9:21092143..21092216 CGACTCCAGTTCCGAGTCTG Chr9:21092163..21092182 61 60
upstream ENSMUSE00000294134 Chr9:21091023..21091128 ATCCCCAGCAGGAGAGAGAC Chr9:21091102..21091121 60.76 60
upstream ENSMUSE00000294109 Chr9:21089685..21089811 CCGAAGCCTCATCTTCAGAG Chr9:21089792..21089811 60.09 55

*** Putative Vector Insertion (Chr 9: 21089684 - 21091129) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000294081 Chr9:21086618..21086672 TCTCCCCATCAGAGTTGTCC Chr9:21086616..21086635 60.05 55
downstream ENSMUSE00000294049 Chr9:21086493..21086542 TTCCTTCAGCTGTTTCTGCTC Chr9:21086473..21086493 59.75 47.62
downstream ENSMUSE00000294023 Chr9:21086259..21086355 TGTCCTCATCACTGCTGTCC Chr9:21086296..21086315 59.83 55
downstream ENSMUSE00000293998 Chr9:21086106..21086183 CTTTTGCCCCTTTAGCCACT Chr9:21086117..21086136 60.6 50
downstream ENSMUSE00000293976 Chr9:21085486..21085613 CAGTCCTGGGTTGTTCCAGT Chr9:21085556..21085575 60 55
downstream ENSMUSE00000293954 Chr9:21084807..21084933 CTCCTCAAAGCGGAAGTTGT Chr9:21084800..21084819 59.47 50
downstream ENSMUSE00000293936 Chr9:21084608..21084703 GTCTCTTCCCGCTTCTCCTT Chr9:21084605..21084624 59.96 55
downstream ENSMUSE00000293916 Chr9:21083805..21083975 AGCTTGGCCAGAATCTCCTT Chr9:21083883..21083902 60.35 50
downstream ENSMUSE00000293885 Chr9:21081004..21081079 CTTCTAGCCCGTCCTCTTCC Chr9:21080982..21081001 60.34 60
downstream ENSMUSE00000293856 Chr9:21080829..21080917 AGTCAGGGTCCTCACAGTGC Chr9:21080812..21080831 60.31 60
downstream ENSMUSE00000293835 Chr9:21080499..21080625 AGACTTGCGCTTTCTCTTGC Chr9:21080523..21080542 59.9 50
downstream ENSMUSE00000293810 Chr9:21080288..21080418 CAGTGCGGTACTTGAAACGA Chr9:21080301..21080320 59.9 50
downstream ENSMUSE00000293771 Chr9:21079881..21079945 CACCAGCGATTCAGTTCCTT Chr9:21079886..21079905 60.26 50
downstream ENSMUSE00000293730 Chr9:21079713..21079811 TTCCTGGCACAGAGACTTGA Chr9:21079693..21079712 59.54 50
downstream ENSMUSE00000293689 Chr9:21077906..21078692 GGCCTTGCTCTGTGACTTTC Chr9:21078625..21078644 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000035047