Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38406
Trapped Gene
Mep1a (ENSMUSG00000023914)
Vector Insertion
Chr 17: 43624037 - 43628705
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136311 (Chr17:43628529..43628704 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136311 (Chr17:43628529..43628704 -)
Downstram Exon
ENSMUSE00000136317 (Chr17:43624038..43624259 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000543289 Chr17:43639602..43639706 No primer for this exon
upstream ENSMUSE00000721087 Chr17:43639602..43639761 No primer for this exon
upstream ENSMUSE00000543287 Chr17:43639490..43639514 No primer for this exon
upstream ENSMUSE00000543286 Chr17:43639337..43639387 No primer for this exon
upstream ENSMUSE00000543285 Chr17:43636340..43636380 No primer for this exon
upstream ENSMUSE00000506834 Chr17:43634849..43634924 No primer for this exon
upstream ENSMUSE00000136318 Chr17:43631808..43631925 No primer for this exon
upstream ENSMUSE00000136311 Chr17:43628529..43628704 No primer for this exon
upstream ENSMUSE00000136317 Chr17:43624038..43624259 No primer for this exon

*** Putative Vector Insertion (Chr 17: 43624037 - 43628705) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000508093 Chr17:43623160..43623309 No primer for this exon
downstream ENSMUSE00000503594 Chr17:43619120..43619335 No primer for this exon
downstream ENSMUSE00000380660 Chr17:43615755..43616225 No primer for this exon
downstream ENSMUSE00000505514 Chr17:43615047..43615220 No primer for this exon
downstream ENSMUSE00000543282 Chr17:43614026..43614326 No primer for this exon
downstream ENSMUSE00000714190 Chr17:43611273..43612058 No primer for this exon
downstream ENSMUSE00000543281 Chr17:43610832..43612058 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCTGATTTGCTCAGTGCT Chr17:43625665..43625685 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCTGATTTGCTCAGTGCT Chr17:43625665..43625685 59.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023914