Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38409
Trapped Gene
1700065O13Rik (ENSMUSG00000067430)
Vector Insertion
Chr 17: 33158650 - 33170114
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699296 (Chr17:33169964..33170113 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAAGCTACTTCGTTCCAG Chr17:33170031..33170050 58.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699296 (Chr17:33169964..33170113 -)
Downstram Exon
ENSMUSE00000547046 (Chr17:33158651..33158777 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAAGCTACTTCGTTCCAG Chr17:33170031..33170050 58.93 55 CCCACTCTCCTGGACTGAAG Chr17:33158704..33158723 59.83 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699283 Chr17:33170227..33170247 No primer for this exon
upstream ENSMUSE00000699296 Chr17:33169964..33170113 GGGAAGCTACTTCGTTCCAG Chr17:33170031..33170050 58.93 55
upstream ENSMUSE00000547046 Chr17:33158651..33158777 GGCTCTGTTGGATTCCAGTC Chr17:33158708..33158727 59.66 55
upstream ENSMUSE00000657703 Chr17:33158651..33158777 GGCTCTGTTGGATTCCAGTC Chr17:33158708..33158727 59.66 55

*** Putative Vector Insertion (Chr 17: 33158650 - 33170114) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699274 Chr17:33158518..33158523 No primer for this exon
downstream ENSMUSE00000699273 Chr17:33158410..33158454 No primer for this exon
downstream ENSMUSE00000433750 Chr17:33158403..33158454 No primer for this exon
downstream ENSMUSE00000699272 Chr17:33157801..33157807 No primer for this exon
downstream ENSMUSE00000547057 Chr17:33156704..33156914 CAAATGGTTTCGCTCCAGTT Chr17:33156690..33156709 60.11 45
downstream ENSMUSE00000699270 Chr17:33156056..33156917 CAAATGGTTTCGCTCCAGTT Chr17:33156690..33156709 60.11 45
downstream ENSMUSE00000699268 Chr17:33155435..33155887 TTCTTTCATGGTTCCGAAGG Chr17:33155523..33155542 60.04 45
downstream ENSMUSE00000478437 Chr17:33153809..33156914 GGTAACGGGCACTCTGATGT Chr17:33155451..33155470 60 55
downstream ENSMUSE00000657702 Chr17:33153809..33153899 TAGGCCAGCCAAGCATACAT Chr17:33153845..33153864 60.63 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTCGTGATAATCGCCTTG Chr17:33164052..33164072 58.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTGACGTGACTGGGAAAAC Chr17:33164048..33164068 61.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067430