Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38414
Trapped Gene
Hsph1 (ENSMUSG00000029657)
Vector Insertion
Chr 5: 150436404 - 150438747
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000514713 (Chr5:150438545..150438746 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGTTGGGCTAGACGTAGG Chr5:150438626..150438645 59.62 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000514713 (Chr5:150438545..150438746 -)
Downstram Exon
ENSMUSE00000191168 (Chr5:150436405..150436462 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGTTGGGCTAGACGTAGG Chr5:150438626..150438645 59.62 60 GGCTGCAACTCCAATTGTTC Chr5:150436392..150436411 60.65 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514713 Chr5:150438545..150438746 GTGGTTGGGCTAGACGTAGG Chr5:150438626..150438645 59.62 60
upstream ENSMUSE00000589256 Chr5:150438545..150438808 GTGGTTGGGCTAGACGTAGG Chr5:150438626..150438645 59.62 60
upstream ENSMUSE00000684152 Chr5:150438545..150438913 ACATAAGGCTGAGCGATTGG Chr5:150438830..150438849 60.24 50
upstream ENSMUSE00000191168 Chr5:150436405..150436462 AATTGGAGTTGCAGCCAAAA Chr5:150436410..150436429 60.62 40

*** Putative Vector Insertion (Chr 5: 150436404 - 150438747) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000191169 Chr5:150434609..150434749 TTGAATGCTCTGCCATGAAA Chr5:150434666..150434685 60.34 40
downstream ENSMUSE00000191162 Chr5:150433962..150434084 CATGGCTGTTATCTGCTCCA Chr5:150434009..150434028 59.82 50
downstream ENSMUSE00000191161 Chr5:150433335..150433434 AAGCAGTTCAAGCCCACAAT Chr5:150433339..150433358 59.74 45
downstream ENSMUSE00000191171 Chr5:150432914..150433047 CCCATGTCAACAAACACCAC Chr5:150432944..150432963 59.7 50
downstream ENSMUSE00000191174 Chr5:150432362..150432606 AGGGCTCGAATTTTGGATTT Chr5:150432460..150432479 59.91 40
downstream ENSMUSE00000191170 Chr5:150431776..150432004 GGCACCTCCCACTATCTCAA Chr5:150431859..150431878 60.07 55
downstream ENSMUSE00000191158 Chr5:150430111..150430217 TTTCTTCCGAGTCGTGGTTC Chr5:150430096..150430115 60.23 50
downstream ENSMUSE00000191164 Chr5:150429830..150429963 GTTCCGACTGAACACCTCGT Chr5:150429917..150429936 60.16 55
downstream ENSMUSE00000460382 Chr5:150427544..150427752 TGTGTTCACACGCACTTTGA Chr5:150427651..150427670 59.91 45
downstream ENSMUSE00000191173 Chr5:150426040..150426171 AGGGGGAGACTGTGAGGTTT Chr5:150426066..150426085 59.97 55
downstream ENSMUSE00000191175 Chr5:150423121..150423258 TGCCATACCAAGTTGGCTTC Chr5:150423139..150423158 61.03 50
downstream ENSMUSE00000191165 Chr5:150422452..150422577 TCCACATAGCTTGTCCCTGA Chr5:150422457..150422476 59.24 50
downstream ENSMUSE00000191163 Chr5:150421536..150421643 GCCAGTCTTCCGTCTCTGTT Chr5:150421576..150421595 59.46 55
downstream ENSMUSE00000191167 Chr5:150421321..150421440 CTCCAACACTTTCGGTCGTT Chr5:150421356..150421375 60.15 50
downstream ENSMUSE00000191159 Chr5:150420962..150421123 TTCGAACAACAGGGTCTTGA Chr5:150420966..150420985 59.26 45
downstream ENSMUSE00000444225 Chr5:150420035..150420285 TTAGGGTGGCATTCACCATT Chr5:150420094..150420113 60.19 45
downstream ENSMUSE00000684151 Chr5:150419744..150420285 TCCAGGTCCATGTTGACAGA Chr5:150420064..150420083 60.09 50
downstream ENSMUSE00000589255 Chr5:150419420..150420285 ACAGGACCCTGACACCAAAG Chr5:150419858..150419877 60 55
downstream ENSMUSE00000589257 Chr5:150416862..150417282 TGTGTCAGAGCGTTTTCCTG Chr5:150417132..150417151 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGACTGGTCGGGAGCATAAT Chr5:150438692..150438712 62.32 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTAAGCCGGAGGCATCTTC Chr5:150438713..150438733 63.23 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029657