Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38419
Trapped Gene
4833422C13Rik (ENSMUSG00000074782)
Vector Insertion
Chr 13: 91853212 - 91881415
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680654 (Chr13:91881027..91881414 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680654 (Chr13:91881027..91881414 -)
Downstram Exon
ENSMUSE00000640792 (Chr13:91853213..91854588 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680654 Chr13:91881027..91881414 No primer for this exon
upstream ENSMUSE00000640792 Chr13:91853213..91854588 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTAATCGCCTTGCAGCAC Chr13:91863347..91863367 62.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATGCGTGCATGAATTTTT Chr13:91878399..91878419 61.93 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074782