Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38422
Trapped Gene
Robo2 (ENSMUSG00000052516)
Vector Insertion
Chr 16: 73996817 - 74009032
Public Clones (sanger) (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698696 (Chr16:74009020..74009031 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698696 (Chr16:74009020..74009031 -)
Downstram Exon
ENSMUSE00000642683 (Chr16:73996818..73996829 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000467785 Chr16:74411097..74411157 TTGCTCTTTGGATTTCTCTGC Chr16:74411110..74411130 59.58 42.86
upstream ENSMUSE00000698695 Chr16:74411097..74412030 AGGAAACCAAGGGGAGAAAA Chr16:74411610..74411629 59.91 45
upstream ENSMUSE00000712927 Chr16:74411097..74411537 TGCTCTCTGGGATTGGTTTC Chr16:74411191..74411210 60.19 50
upstream ENSMUSE00000714056 Chr16:74411097..74411234 TGCTCTCTGGGATTGGTTTC Chr16:74411191..74411210 60.19 50
upstream ENSMUSE00000717868 Chr16:74411097..74412030 AGGAAACCAAGGGGAGAAAA Chr16:74411610..74411629 59.91 45
upstream ENSMUSE00000499472 Chr16:74352796..74353122 AGCCCACCACTCTGAACTGT Chr16:74353028..74353047 59.76 55
upstream ENSMUSE00000433345 Chr16:74047025..74047182 GAGATGACTTCCGGCAAAAC Chr16:74047157..74047176 59.68 50
upstream ENSMUSE00000698698 Chr16:74047025..74047186 GAGATGACTTCCGGCAAAAC Chr16:74047157..74047176 59.68 50
upstream ENSMUSE00000698713 Chr16:74047025..74047190 GAGATGACTTCCGGCAAAAC Chr16:74047157..74047176 59.68 50
upstream ENSMUSE00000433335 Chr16:74046067..74046187 GGAACCAATATGGTGGGAGA Chr16:74046102..74046121 59.6 50
upstream ENSMUSE00000698697 Chr16:74046067..74046187 GGAACCAATATGGTGGGAGA Chr16:74046102..74046121 59.6 50
upstream ENSMUSE00000506064 Chr16:74035230..74035368 ATTCCGTTGTCAGGTCCAAG Chr16:74035288..74035307 59.97 50
upstream ENSMUSE00000504033 Chr16:74016116..74016243 GAGAATCGGGTGGGAAAAGT Chr16:74016145..74016164 60.31 50
upstream ENSMUSE00000698696 Chr16:74009020..74009031 No primer for this exon
upstream ENSMUSE00000642683 Chr16:73996818..73996829 No primer for this exon

*** Putative Vector Insertion (Chr 16: 73996817 - 74009032) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000710135 Chr16:73986178..73986189 No primer for this exon
downstream ENSMUSE00000493265 Chr16:73985833..73985957 TGGCTGTGGGTTTCCTTTAG Chr16:73985841..73985860 60.1 50
downstream ENSMUSE00000506606 Chr16:73982226..73982397 CTGAGGTTGATTCGGGAAAA Chr16:73982349..73982368 60.04 45
downstream ENSMUSE00000512348 Chr16:73978653..73978858 TCTTGGATCTCTCCCCAGAA Chr16:73978676..73978695 59.73 50
downstream ENSMUSE00000513394 Chr16:73973950..73974031 CTGTTACATCCAGCACTGCAC Chr16:73973928..73973948 59.38 52.38
downstream ENSMUSE00000511266 Chr16:73973398..73973560 TCAATGATATACGCGCTTGC Chr16:73973385..73973404 59.83 45
downstream ENSMUSE00000500556 Chr16:73971299..73971465 TGCGTACAGGATCCGACATA Chr16:73971283..73971302 60.1 50
downstream ENSMUSE00000501579 Chr16:73968013..73968134 TGTCTGTGGTCCACTCCTTG Chr16:73968076..73968095 59.71 55
downstream ENSMUSE00000484042 Chr16:73961924..73962155 CCCGAAGTCTGACGGTACAT Chr16:73962075..73962094 59.99 55
downstream ENSMUSE00000488535 Chr16:73958549..73958673 TGATGCTTGTGCTGTTGTGA Chr16:73958586..73958605 60.03 45
downstream ENSMUSE00000487529 Chr16:73956733..73956904 GCTGCATCCACCGTTTTATT Chr16:73956827..73956846 59.97 45
downstream ENSMUSE00000498042 Chr16:73948448..73948630 CATCCGTGATTTGCTCAGTG Chr16:73948546..73948565 60.26 50
downstream ENSMUSE00000495739 Chr16:73940501..73940543 CCATTGCTCATTAGTCCTCCA Chr16:73940482..73940502 60.08 47.62
downstream ENSMUSE00000494727 Chr16:73938976..73939103 GGATCGCCAGCATTTAGAAG Chr16:73939052..73939071 59.81 50
downstream ENSMUSE00000485740 Chr16:73933832..73934113 CAGTTCGTGGATGCTGTTTG Chr16:73933913..73933932 60.3 50
downstream ENSMUSE00000698702 Chr16:73933291..73933416 CCAATCGGTAGTCAGGGATG Chr16:73933365..73933384 60.33 55
downstream ENSMUSE00000470989 Chr16:73928269..73928422 TCTTGTTCCGCAGCATAGTG Chr16:73928253..73928272 60.01 50
downstream ENSMUSE00000468283 Chr16:73920779..73921039 AGCATGGGTTGCATCTCTTC Chr16:73920817..73920836 60.23 50
downstream ENSMUSE00000698686 Chr16:73920451..73921039 GAACGCTGGTCTGTGAATGA Chr16:73920486..73920505 59.84 50
downstream ENSMUSE00000469188 Chr16:73916343..73916548 GTTGTGGAGGTGGGGTATTG Chr16:73916495..73916514 60.09 55
downstream ENSMUSE00000473218 Chr16:73904628..73904801 TCCCTCCGATGAGGTAACAC Chr16:73904620..73904639 59.93 55
downstream ENSMUSE00000475090 Chr16:73899157..73899429 CTGCTGCCTTAAACCCTGAC Chr16:73899358..73899377 59.88 55
downstream ENSMUSE00000698701 Chr16:73897261..73897452 GAAGGTCATTGGCATTCCTC Chr16:73897284..73897303 59.49 50
downstream ENSMUSE00000463747 Chr16:73897259..73897452 GAAGGTCATTGGCATTCCTC Chr16:73897284..73897303 59.49 50
downstream ENSMUSE00000698691 Chr16:73897252..73897452 GAAGGTCATTGGCATTCCTC Chr16:73897284..73897303 59.49 50
downstream ENSMUSE00000709629 Chr16:73894600..73896075 AGCCGAGTATGCTCGAAGAA Chr16:73894990..73895009 60.12 50
downstream ENSMUSE00000698700 Chr16:73892551..73896075 GATTTTGCGGGAATCACAGT Chr16:73893594..73893613 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr16:73999962..73999982 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTTCGTGACTGGGAAAAC Chr16:73999966..73999986 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052516