Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38424
Trapped Gene
Pde1c (ENSMUSG00000004347)
Vector Insertion
Chr 6: 56131677 - 56295147
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000560945 (Chr6:56295120..56295146 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000560945 (Chr6:56295120..56295146 -)
Downstram Exon
ENSMUSE00000560943 (Chr6:56131678..56131791 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGCTTGACCAAAGACCGTAA Chr6:56131749..56131768 59.32 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486636 Chr6:56311739..56312171 TCCCGGACACAGTCCTTATC Chr6:56312072..56312091 59.93 55
upstream ENSMUSE00000654503 Chr6:56311739..56312305 TCCCGGACACAGTCCTTATC Chr6:56312072..56312091 59.93 55
upstream ENSMUSE00000560945 Chr6:56295120..56295146 No primer for this exon
upstream ENSMUSE00000560943 Chr6:56131678..56131791 TTACGGTCTTTGGTCAAGCA Chr6:56131771..56131790 59.32 45

*** Putative Vector Insertion (Chr 6: 56131677 - 56295147) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000560940 Chr6:56130063..56130245 TCCTAAGCATCATCCCCATC Chr6:56130108..56130127 59.85 50
downstream ENSMUSE00000560938 Chr6:56129087..56129153 CCATGTTTGATGTCCGTCTG Chr6:56129106..56129125 59.96 50
downstream ENSMUSE00000560936 Chr6:56124902..56125018 ATCGAAGGACCACGTATCCA Chr6:56124973..56124992 60.34 50
downstream ENSMUSE00000560932 Chr6:56123597..56123737 TGCATGCATCAGGTTATGGT Chr6:56123626..56123645 59.96 45
downstream ENSMUSE00000560930 Chr6:56108921..56109021 No primer for this exon
downstream ENSMUSE00000560928 Chr6:56107017..56107145 GTAGGCTGCACTCAGGTGGT Chr6:56107057..56107076 60.33 60
downstream ENSMUSE00000560927 Chr6:56101286..56101387 TGTGGCCATTACCATCTCAA Chr6:56101326..56101345 59.92 45
downstream ENSMUSE00000560924 Chr6:56100590..56100710 TAAGGCTTTCGGCTTCTCAA Chr6:56100667..56100686 60.09 45
downstream ENSMUSE00000560922 Chr6:56092088..56092169 CCACTTGTGACTGAGCAACC Chr6:56092066..56092085 59.31 55
downstream ENSMUSE00000560921 Chr6:56089385..56089505 AGTCTGGGAGCTTTCGTCAA Chr6:56089389..56089408 59.99 50
downstream ENSMUSE00000560918 Chr6:56087339..56087514 GATTGATCTGCACCACCTCA Chr6:56087347..56087366 59.64 50
downstream ENSMUSE00000560917 Chr6:56076853..56077074 CTTTGGAGTTCTTCCCACGA Chr6:56076861..56076880 60.22 50
downstream ENSMUSE00000516483 Chr6:56072986..56073063 ATTTCCGGTGTTGGAGTGAT Chr6:56072983..56073002 59.26 45
downstream ENSMUSE00000698930 Chr6:56072869..56072879 No primer for this exon
downstream ENSMUSE00000517599 Chr6:56041357..56041425 GGCAAGGTAATGCGACTTGT Chr6:56041337..56041356 60.14 50
downstream ENSMUSE00000698936 Chr6:56029982..56032182 GAGATGGAGCTTCGTTCCTG Chr6:56030505..56030524 59.95 55
downstream ENSMUSE00000342608 Chr6:56022200..56022369 CGGAAGGTGCATAGGAGCTA Chr6:56022282..56022301 60.37 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCCATGTGCTGGTGAGTC Chr6:56196176..56196196 58.67 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTCCATGTGCTGGTGAGTC Chr6:56196176..56196196 58.67 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004347