Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38425
Trapped Gene
Lrrfip1 (ENSMUSG00000026305)
Vector Insertion
Chr 1: 92985289 - 92988178
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000659870 (Chr1:92985211..92985288 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTGTCTACCCAGAATGGA Chr1:92985263..92985282 59.92 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000659870 (Chr1:92985211..92985288 +)
Downstram Exon
ENSMUSE00000659869 (Chr1:92988179..92988244 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTGTCTACCCAGAATGGA Chr1:92985263..92985282 59.92 55 CCCATAGAGGCTGCTCTCATC Chr1:92988213..92988233 61.26 57.14

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418651 Chr1:92895381..92895470 No primer for this exon
upstream ENSMUSE00000659871 Chr1:92950084..92950300 TTGGTCTGCACTTCACTTCG Chr1:92950210..92950229 60.03 50
upstream ENSMUSE00000157789 Chr1:92965140..92965226 CTCGAGAGATCCGGATGAAG Chr1:92965183..92965202 59.9 55
upstream ENSMUSE00000694111 Chr1:92969901..92969918 No primer for this exon
upstream ENSMUSE00000157792 Chr1:92973521..92973568 ATACAAAATGGGGCGACATC Chr1:92973537..92973556 59.65 45
upstream ENSMUSE00000157785 Chr1:92974968..92975012 AGATTCCGGAGAAACACGTC Chr1:92974992..92975011 59.14 50
upstream ENSMUSE00000157794 Chr1:92975608..92975658 No primer for this exon
upstream ENSMUSE00000157784 Chr1:92981523..92981582 TGTGGATCCCAGTCCCTAAG Chr1:92981547..92981566 59.92 55
upstream ENSMUSE00000659870 Chr1:92985211..92985288 CCCTGTCTACCCAGAATGGA Chr1:92985263..92985282 59.92 55

*** Putative Vector Insertion (Chr 1: 92985289 - 92988178) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000659869 Chr1:92988179..92988244 CCCATAGAGGCTGCTCTCATC Chr1:92988213..92988233 61.26 57.14
downstream ENSMUSE00000157793 Chr1:92990137..92990214 TGAGGTGGCTGCCATATTCT Chr1:92990164..92990183 60.62 50
downstream ENSMUSE00000157788 Chr1:92997154..92997189 No primer for this exon
downstream ENSMUSE00000157790 Chr1:92997762..92997887 ACAGGCTAGGCATGTTACGG Chr1:92997789..92997808 60.15 55
downstream ENSMUSE00000157787 Chr1:92999824..92999895 CCCTGCATGTATTTGCCTTC Chr1:92999882..92999901 60.47 50
downstream ENSMUSE00000541867 Chr1:93001704..93001874 CTCGTATTGCCGCTGAGACT Chr1:93001865..93001884 60.56 55
downstream ENSMUSE00000157782 Chr1:93003875..93003967 CCTCTTTCACTTCGGCAAAC Chr1:93003941..93003960 59.85 50
downstream ENSMUSE00000714156 Chr1:93005157..93005249 ATAAAACCCGCCTGTTTCTG Chr1:93005197..93005216 59.09 45
downstream ENSMUSE00000718249 Chr1:93005157..93005249 ATAAAACCCGCCTGTTTCTG Chr1:93005197..93005216 59.09 45
downstream ENSMUSE00000659867 Chr1:93006932..93007024 TCGTTCGCTCCTTATGGAAT Chr1:93006982..93007001 59.67 45
downstream ENSMUSE00000694102 Chr1:93006932..93007024 TCGTTCGCTCCTTATGGAAT Chr1:93006982..93007001 59.67 45
downstream ENSMUSE00000659874 Chr1:93008733..93008874 GGCTTGATACCCAACGTCAT Chr1:93008816..93008835 59.82 50
downstream ENSMUSE00000694101 Chr1:93008733..93008874 GGCTTGATACCCAACGTCAT Chr1:93008816..93008835 59.82 50
downstream ENSMUSE00000659864 Chr1:93011173..93012641 CTTCCCGCTCTGATTTTCTG Chr1:93012295..93012314 59.95 50
downstream ENSMUSE00000518178 Chr1:93016718..93016767 CCCGTTCATCAATGAGCTTT Chr1:93016753..93016772 60.07 45
downstream ENSMUSE00000694098 Chr1:93016718..93016767 CCCGTTCATCAATGAGCTTT Chr1:93016753..93016772 60.07 45
downstream ENSMUSE00000289759 Chr1:93018999..93019116 TCCCATTCTCCAAGATACCG Chr1:93019092..93019111 59.89 50
downstream ENSMUSE00000694097 Chr1:93018999..93019116 TCCCATTCTCCAAGATACCG Chr1:93019092..93019111 59.89 50
downstream ENSMUSE00000289754 Chr1:93019655..93019734 No primer for this exon
downstream ENSMUSE00000694096 Chr1:93019655..93019734 No primer for this exon
downstream ENSMUSE00000519065 Chr1:93022218..93022322 ATCGATAGCGCGTTACTTGG Chr1:93022257..93022276 60.25 50
downstream ENSMUSE00000659866 Chr1:93022218..93022322 ATCGATAGCGCGTTACTTGG Chr1:93022257..93022276 60.25 50
downstream ENSMUSE00000633905 Chr1:93024663..93025485 TCTAGACCATCGCCTCGACT Chr1:93025284..93025303 59.97 55
downstream ENSMUSE00000659865 Chr1:93024663..93025485 TCTAGACCATCGCCTCGACT Chr1:93025284..93025303 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTGTCTACCCAGAATGGA Chr1:92985264..92985284 59.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACGTAGAGCGTGACTGG Chr1:92985329..92985349 60.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026305