Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38435
Trapped Gene
Wnt3a (ENSMUSG00000009900)
Vector Insertion
Chr 11: 59061555 - 59070048
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104669 (Chr11:59069782..59070047 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104669 (Chr11:59069782..59070047 -)
Downstram Exon
ENSMUSE00000370057 (Chr11:59061556..59063611 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000397954 Chr11:59104079..59104254 No primer for this exon
upstream ENSMUSE00000104673 Chr11:59088642..59088883 No primer for this exon
upstream ENSMUSE00000104669 Chr11:59069782..59070047 No primer for this exon
upstream ENSMUSE00000370057 Chr11:59061556..59063611 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTCAGATAATCGCCTTGC Chr11:59069985..59070005 58.87 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGACGTGACTGGGAAAACC Chr11:59069981..59070001 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009900