Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38442
Trapped Gene
AL683890.7 (ENSMUSG00000078699)
Vector Insertion
Chr 4: 55363300 - 55363769
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673949 (Chr4:55362924..55363299 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAGGTAGCGGGTTCTCTG Chr4:55362971..55362990 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673949 (Chr4:55362924..55363299 +)
Downstram Exon
ENSMUSE00000673948 (Chr4:55363770..55364117 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAGGTAGCGGGTTCTCTG Chr4:55362971..55362990 59.87 60 ACGTGGCCTCAGAACGTAAT Chr4:55363817..55363836 59.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673949 Chr4:55362924..55363299 GTGAGGTAGCGGGTTCTCTG Chr4:55362971..55362990 59.87 60

*** Putative Vector Insertion (Chr 4: 55363300 - 55363769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000673948 Chr4:55363770..55364117 ACGTGGCCTCAGAACGTAAT Chr4:55363817..55363836 59.62 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGACCTTCAAGATCGACA Chr4:55363264..55363284 58.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGACCTTCAAGATCGACA Chr4:55363264..55363284 58.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078699