Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38447
Trapped Gene
AY616753 (ENSMUSG00000068082)
Vector Insertion
Chr 5: 68501794 - 68547065
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000598904 (Chr5:68501551..68501793 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCTTCGAGAGATGCGAAC Chr5:68501619..68501638 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000598904 (Chr5:68501551..68501793 +)
Downstram Exon
ENSMUSE00000598903 (Chr5:68547066..68547131 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCTTCGAGAGATGCGAAC Chr5:68501619..68501638 59.96 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000598905 Chr5:68423074..68423528 TCGAATTGCCTCATCTCACA Chr5:68423198..68423217 60.35 45
upstream ENSMUSE00000598904 Chr5:68501551..68501793 GACCTTCGAGAGATGCGAAC Chr5:68501619..68501638 59.96 55

*** Putative Vector Insertion (Chr 5: 68501794 - 68547065) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000598903 Chr5:68547066..68547131 No primer for this exon
downstream ENSMUSE00000598902 Chr5:68557331..68557633 ACAACGCTGGAGACCATTCT Chr5:68557495..68557514 59.73 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCATGCCTCTCTGGAACT Chr5:68525803..68525823 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTGCCAGAAAAAGTTATCATCA Chr5:68507793..68507817 59.68 33.33 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068082