Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38461
Trapped Gene
Rec8 (ENSMUSG00000002324)
Vector Insertion
Chr 14: 56244017 - 56244112
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000124498 (Chr14:56243910..56244016 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGCTTCTCGGGTCTTCTA Chr14:56243986..56244005 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000124498 (Chr14:56243910..56244016 +)
Downstram Exon
ENSMUSE00000342015 (Chr14:56244113..56244226 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGCTTCTCGGGTCTTCTA Chr14:56243986..56244005 59.95 50 GCCCATATGGCTTCTGTTGT Chr14:56244166..56244185 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349839 Chr14:56237007..56237190 AAGGCCTCTTGACCAGAAGA Chr14:56237083..56237102 59.01 50
upstream ENSMUSE00000352974 Chr14:56237383..56237495 ACCCAGGAGCAAAGATGTTC Chr14:56237426..56237445 59.14 50
upstream ENSMUSE00000124511 Chr14:56237579..56237647 CGTTTGGTGAAGCGTGAATA Chr14:56237601..56237620 59.73 45
upstream ENSMUSE00000124500 Chr14:56237735..56237877 CCAGCTTCAGATTGGTGTGA Chr14:56237822..56237841 59.83 50
upstream ENSMUSE00000124507 Chr14:56237958..56238033 ATCCTGGAGCACCTACATCG Chr14:56237972..56237991 60.1 55
upstream ENSMUSE00000124494 Chr14:56238417..56238537 GATGGAGACGCTGGAAGATG Chr14:56238450..56238469 60.77 55
upstream ENSMUSE00000124501 Chr14:56240072..56240156 CGTAAGGAGACCCTTCCTGA Chr14:56240111..56240130 59.28 55
upstream ENSMUSE00000124506 Chr14:56241052..56241131 CACCTTACAGGAGGCAGAGC Chr14:56241089..56241108 60.01 60
upstream ENSMUSE00000124512 Chr14:56241264..56241399 GCGGAGAGCTTCACTACCAC Chr14:56241374..56241393 60.02 60
upstream ENSMUSE00000124510 Chr14:56241482..56241554 CCCTAGAAGGTGCTGGTTTG Chr14:56241503..56241522 59.73 55
upstream ENSMUSE00000124497 Chr14:56241631..56241722 ACTACCAGGCCAGGTCTTCC Chr14:56241652..56241671 60.51 60
upstream ENSMUSE00000316404 Chr14:56242001..56242050 No primer for this exon
upstream ENSMUSE00000124499 Chr14:56242334..56242471 CGGCGCCAGTTATTATTCTG Chr14:56242379..56242398 60.6 50
upstream ENSMUSE00000124504 Chr14:56242758..56242824 CCCAAGAGGATGCTCACAAG Chr14:56242773..56242792 60.79 55
upstream ENSMUSE00000124509 Chr14:56242913..56243079 GGCTACCCCCAGAACTCCTA Chr14:56242919..56242938 60.46 60
upstream ENSMUSE00000124495 Chr14:56243186..56243234 No primer for this exon
upstream ENSMUSE00000124503 Chr14:56243560..56243623 GCTCTCCCTAGAAGCAGCAG Chr14:56243561..56243580 59.48 60
upstream ENSMUSE00000124505 Chr14:56243722..56243838 ATGCTGCCTGAACTTCCTGA Chr14:56243765..56243784 60.94 50
upstream ENSMUSE00000124498 Chr14:56243910..56244016 TTGGCTTCTCGGGTCTTCTA Chr14:56243986..56244005 59.95 50

*** Putative Vector Insertion (Chr 14: 56244017 - 56244112) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000342015 Chr14:56244113..56244226 GCCCATATGGCTTCTGTTGT Chr14:56244166..56244185 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGTTGGCTTCTCGGGTCT Chr14:56243983..56244003 60.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGTTGGCTTCTCGGGTCT Chr14:56243983..56244003 60.25 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002324