Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38465
Trapped Gene
C1s (ENSMUSG00000038521)
Vector Insertion
Chr 6: 124491350 - 124586185
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000489210 (Chr6:124586082..124586184 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000489210 (Chr6:124586082..124586184 -)
Downstram Exon
ENSMUSE00000709663 (Chr6:124491351..124491395 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000487042 Chr6:124586934..124586997 No primer for this exon
upstream ENSMUSE00000489210 Chr6:124586082..124586184 No primer for this exon
upstream ENSMUSE00000709663 Chr6:124491351..124491395 No primer for this exon
upstream ENSMUSE00000711065 Chr6:124491351..124491395 No primer for this exon

*** Putative Vector Insertion (Chr 6: 124491350 - 124586185) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000305300 Chr6:124490807..124491014 No primer for this exon
downstream ENSMUSE00000651557 Chr6:124490807..124491014 No primer for this exon
downstream ENSMUSE00000361350 Chr6:124490339..124490516 No primer for this exon
downstream ENSMUSE00000691950 Chr6:124489924..124489939 No primer for this exon
downstream ENSMUSE00000691949 Chr6:124489812..124489837 No primer for this exon
downstream ENSMUSE00000691948 Chr6:124488214..124488219 No primer for this exon
downstream ENSMUSE00000248809 Chr6:124487379..124487504 No primer for this exon
downstream ENSMUSE00000651555 Chr6:124487379..124487477 No primer for this exon
downstream ENSMUSE00000691947 Chr6:124486415..124486549 No primer for this exon
downstream ENSMUSE00000476848 Chr6:124486350..124486549 No primer for this exon
downstream ENSMUSE00000691946 Chr6:124485825..124485873 No primer for this exon
downstream ENSMUSE00000477713 Chr6:124485251..124485404 No primer for this exon
downstream ENSMUSE00000691945 Chr6:124485251..124485417 No primer for this exon
downstream ENSMUSE00000479108 Chr6:124484376..124484491 No primer for this exon
downstream ENSMUSE00000480018 Chr6:124483914..124483992 No primer for this exon
downstream ENSMUSE00000480884 Chr6:124483292..124483420 No primer for this exon
downstream ENSMUSE00000691942 Chr6:124482799..124482808 No primer for this exon
downstream ENSMUSE00000481772 Chr6:124482559..124482633 No primer for this exon
downstream ENSMUSE00000691940 Chr6:124482559..124482641 No primer for this exon
downstream ENSMUSE00000464711 Chr6:124480407..124481758 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTGTTGGAGGGAGGACAA Chr6:124499211..124499231 59.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACACAGGAGATCCATCC Chr6:124499189..124499209 58.42 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038521