Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38472
Trapped Gene
Gpr98 (ENSMUSG00000069170)
Vector Insertion
Chr 13: 81245901 - 81294276
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000248936 (Chr13:81294154..81294275 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACTGCATATGGCCTACAGA Chr13:81294199..81294219 60.11 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000248936 (Chr13:81294154..81294275 -)
Downstram Exon
ENSMUSE00000248930 (Chr13:81245902..81246090 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACTGCATATGGCCTACAGA Chr13:81294199..81294219 60.11 52.38 TCCTGGGTGACCATTCATTT Chr13:81245973..81245992 60.17 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680803 Chr13:81772006..81772143 GGAAAGGATTAGCGTTGCAG Chr13:81772122..81772141 59.85 50
upstream ENSMUSE00000640938 Chr13:81734420..81734435 No primer for this exon
upstream ENSMUSE00000640937 Chr13:81734176..81734360 CGCAAATGTTACTGCCATTG Chr13:81734181..81734200 60.13 45
upstream ENSMUSE00000641019 Chr13:81734176..81734357 CGCAAATGTTACTGCCATTG Chr13:81734181..81734200 60.13 45
upstream ENSMUSE00000641018 Chr13:81731989..81732138 CTGCCAGAGGAACAAACAGG Chr13:81732064..81732083 60.82 55
upstream ENSMUSE00000641017 Chr13:81731557..81731652 AGGGCTGCTTCTGTGACAAT Chr13:81731600..81731619 59.87 50
upstream ENSMUSE00000641016 Chr13:81723040..81723144 ATCTCGGTGATTGAGCCAAG Chr13:81723116..81723135 60.22 50
upstream ENSMUSE00000641015 Chr13:81720691..81720804 CAAATCCCCCTGAGGAAGAC Chr13:81720772..81720791 60.82 55
upstream ENSMUSE00000641014 Chr13:81718284..81718849 GCTTCGTGGGAAGGATAGTG Chr13:81718654..81718673 59.69 55
upstream ENSMUSE00000641013 Chr13:81717719..81717995 TGCCTCACACCATACAAGGA Chr13:81717746..81717765 60.11 50
upstream ENSMUSE00000641012 Chr13:81717062..81717391 AGCCCTAGTGAGCGATCCTT Chr13:81717291..81717310 60.37 55
upstream ENSMUSE00000641011 Chr13:81713958..81714134 CCCAGATTCGGAGAAATCAG Chr13:81714064..81714083 59.62 50
upstream ENSMUSE00000641010 Chr13:81712214..81712437 GGATGACGCAGGTCCTTTTA Chr13:81712323..81712342 60.07 50
upstream ENSMUSE00000680765 Chr13:81709482..81709564 TCTGTGTTGACAGGGTGGAA Chr13:81709508..81709527 60.13 50
upstream ENSMUSE00000641009 Chr13:81707607..81707733 CGTGGACAGTGACGTCCTAA Chr13:81707708..81707727 59.74 55
upstream ENSMUSE00000641008 Chr13:81707336..81707521 AAACAGTTCCTCCGCTTTCA Chr13:81707451..81707470 59.85 45
upstream ENSMUSE00000641007 Chr13:81706330..81706510 GGCTGTGCTACACTCGTCAA Chr13:81706434..81706453 60.06 55
upstream ENSMUSE00000641006 Chr13:81705261..81705424 AACTCGAGGCAACTTTGGTG Chr13:81705386..81705405 60.29 50
upstream ENSMUSE00000641005 Chr13:81703981..81704104 GAGCTCAAACAGGGATCAGG Chr13:81704033..81704052 59.8 55
upstream ENSMUSE00000641004 Chr13:81702563..81702829 AGACTTCGCTCCTGTGGAGA Chr13:81702683..81702702 60.13 55
upstream ENSMUSE00000641003 Chr13:81700453..81700579 AATTGAAGCCAACGATGACC Chr13:81700520..81700539 59.94 45
upstream ENSMUSE00000641002 Chr13:81699649..81699863 CCAGTCATTCTCCGTGCTTT Chr13:81699708..81699727 60.26 50
upstream ENSMUSE00000640933 Chr13:81699573..81699863 CCAGTCATTCTCCGTGCTTT Chr13:81699708..81699727 60.26 50
upstream ENSMUSE00000641001 Chr13:81697919..81698650 TGCCCAGAGGCATAAAGAGT Chr13:81697944..81697963 59.84 50
upstream ENSMUSE00000641000 Chr13:81695949..81696322 TGGGATCCTGAGAATTGGAG Chr13:81696299..81696318 60 50
upstream ENSMUSE00000640999 Chr13:81683467..81683643 AGAGGAGGGGTCCACTGTTT Chr13:81683619..81683638 59.97 55
upstream ENSMUSE00000640998 Chr13:81682368..81682548 AGTGGTGCCAGCATAGATCC Chr13:81682418..81682437 60.1 55
upstream ENSMUSE00000640997 Chr13:81678958..81679160 ATGGCGAAATCCGTTTACTG Chr13:81679045..81679064 59.96 45
upstream ENSMUSE00000640996 Chr13:81675309..81675438 GCACTGCTGGCACATTAGAA Chr13:81675418..81675437 60.02 50
upstream ENSMUSE00000640995 Chr13:81672010..81672090 ACACGGATTTCTTCCTTCCA Chr13:81672026..81672045 59.53 45
upstream ENSMUSE00000640994 Chr13:81670566..81670705 GCCCTGAATCACTCTTCGTC Chr13:81670611..81670630 59.81 55
upstream ENSMUSE00000640993 Chr13:81667448..81668057 TGGAAAAGCCACCGTATTTC Chr13:81667641..81667660 59.94 45
upstream ENSMUSE00000640992 Chr13:81664313..81664528 CTGTGGCCCATCTCGTTATT Chr13:81664473..81664492 59.96 50
upstream ENSMUSE00000640991 Chr13:81663558..81663773 TGATGACCCCTACGGACTGT Chr13:81663561..81663580 60.39 55
upstream ENSMUSE00000640990 Chr13:81662535..81662779 GTGAGGGTAAACGTGCCAAT Chr13:81662713..81662732 59.86 50
upstream ENSMUSE00000640989 Chr13:81661104..81661285 GGGTTAGATCGAGTGGCAAA Chr13:81661221..81661240 60.07 50
upstream ENSMUSE00000640988 Chr13:81659502..81660313 GTAGTGGCTCGTGCAGTTGA Chr13:81660242..81660261 60.06 55
upstream ENSMUSE00000640987 Chr13:81656952..81657161 CATCTTGGCAAACGACAATG Chr13:81657006..81657025 60.11 45
upstream ENSMUSE00000640985 Chr13:81650494..81650624 TGCTAACTTTACGGGCCAAC Chr13:81650508..81650527 60.13 50
upstream ENSMUSE00000640984 Chr13:81649849..81649948 No primer for this exon
upstream ENSMUSE00000640983 Chr13:81648365..81648544 GTGCTCCAGGAGGCTAATGT Chr13:81648406..81648425 59.31 55
upstream ENSMUSE00000640982 Chr13:81647655..81647818 GCCATCAATGTCACGTATGC Chr13:81647797..81647816 59.96 50
upstream ENSMUSE00000640981 Chr13:81645098..81645191 TGGCTCCTCTGACTTCATCTC Chr13:81645110..81645130 59.54 52.38
upstream ENSMUSE00000680764 Chr13:81644732..81645191 GCAACCTGCAAGGTGGTATT Chr13:81644832..81644851 60 50
upstream ENSMUSE00000640979 Chr13:81643091..81643169 CTGACGGCACAGATTGTCAT Chr13:81643139..81643158 59.71 50
upstream ENSMUSE00000640978 Chr13:81642853..81642991 ACACTGGTAGCGCAGAGGAG Chr13:81642941..81642960 60.61 60
upstream ENSMUSE00000640977 Chr13:81642002..81642143 GTGGACGTCATGATTCTGGA Chr13:81642088..81642107 59.48 50
upstream ENSMUSE00000640975 Chr13:81637984..81638246 TCAGGGAACCGACATCTCTC Chr13:81638155..81638174 60.2 55
upstream ENSMUSE00000640974 Chr13:81635191..81635366 AGACACGGAACCAGAAATGG Chr13:81635324..81635343 59.97 50
upstream ENSMUSE00000640972 Chr13:81633573..81633697 CCTTGACTTGACTGCGAGTG Chr13:81633612..81633631 59.62 55
upstream ENSMUSE00000640970 Chr13:81632114..81632271 TTTATCGATGGCAAGGGACT Chr13:81632129..81632148 59.53 45
upstream ENSMUSE00000640969 Chr13:81631873..81632019 GCGTTTCCCCATATCTTGTG Chr13:81631954..81631973 60.33 50
upstream ENSMUSE00000640968 Chr13:81631456..81631563 No primer for this exon
upstream ENSMUSE00000640967 Chr13:81627906..81628170 GTCCTCAGGCGATGATGTTT Chr13:81627936..81627955 60.08 50
upstream ENSMUSE00000640965 Chr13:81626851..81626973 AATCCGTTCCTTCACACCAG Chr13:81626863..81626882 59.97 50
upstream ENSMUSE00000640964 Chr13:81620848..81621070 CTCTTTCGTCCTGGAAGCAC Chr13:81620984..81621003 59.99 55
upstream ENSMUSE00000640963 Chr13:81620312..81620516 CACTGTTCTCGCCAATGATG Chr13:81620341..81620360 60.26 50
upstream ENSMUSE00000640962 Chr13:81618628..81618774 TTGGAACGAGATAGCCTGGT Chr13:81618728..81618747 59.69 50
upstream ENSMUSE00000640961 Chr13:81615480..81615735 GGACCCATTGAAAGGTGCTA Chr13:81615594..81615613 59.93 50
upstream ENSMUSE00000640960 Chr13:81613931..81614133 TGGGGACATTTCCATTCACT Chr13:81614065..81614084 60.17 45
upstream ENSMUSE00000640959 Chr13:81611882..81612058 GGATGGAGTCAGCGGAGATA Chr13:81611936..81611955 60.18 55
upstream ENSMUSE00000640958 Chr13:81611395..81611577 AAGTTCCTGTTGTCCGGATG Chr13:81611503..81611522 59.97 50
upstream ENSMUSE00000640957 Chr13:81605161..81605340 GGTGATGATGTTTCGGTGAA Chr13:81605219..81605238 59.35 45
upstream ENSMUSE00000640956 Chr13:81598675..81598839 AAAGGAGCTGTCCGACTTCA Chr13:81598742..81598761 59.99 50
upstream ENSMUSE00000640955 Chr13:81587834..81587951 ACACTTAAGGACGGCATGGT Chr13:81587902..81587921 59.48 50
upstream ENSMUSE00000640953 Chr13:81585378..81585498 ATTATTGGGGAACCCTCAGC Chr13:81585405..81585424 60.15 50
upstream ENSMUSE00000640950 Chr13:81584212..81584350 ACAACTGACGATGCTGGATG Chr13:81584241..81584260 59.71 50
upstream ENSMUSE00000640949 Chr13:81583849..81584034 CATGAGCAGCTTCACGTTTC Chr13:81583865..81583884 59.6 50
upstream ENSMUSE00000640948 Chr13:81583345..81583577 CCTGAGGAATTCGTTCTTGC Chr13:81583372..81583391 59.81 50
upstream ENSMUSE00000612498 Chr13:81581465..81581613 GGGAACATCTCCATTGTTCG Chr13:81581536..81581555 60.32 50
upstream ENSMUSE00000612497 Chr13:81579047..81579242 AGGCTTCATGGAACGTATGG Chr13:81579185..81579204 59.96 50
upstream ENSMUSE00000612496 Chr13:81578412..81578631 CGCCACCTAGTGAGCAAAAT Chr13:81578551..81578570 60.27 50
upstream ENSMUSE00000612495 Chr13:81576468..81576704 TTTTGGAGACGGAGAAGGTG Chr13:81576596..81576615 60.22 50
upstream ENSMUSE00000612494 Chr13:81574559..81574708 GGGGATCCGAATGGAGTTAT Chr13:81574677..81574696 59.98 50
upstream ENSMUSE00000612493 Chr13:81572424..81572897 ACGAGGATTTTTCACCATCG Chr13:81572825..81572844 59.93 45
upstream ENSMUSE00000249073 Chr13:81566602..81566745 CAATTCTCCAGGAAGCGAAG Chr13:81566644..81566663 59.95 50
upstream ENSMUSE00000249066 Chr13:81563222..81563396 GTCATTGGCAACATGACACC Chr13:81563230..81563249 59.82 50
upstream ENSMUSE00000249058 Chr13:81561128..81561263 GAGAGGAAGGGAGTCCTGCT Chr13:81561218..81561237 59.95 60
upstream ENSMUSE00000249048 Chr13:81557995..81559097 AACATGGGCATTCGAAGAAG Chr13:81558199..81558218 60.07 45
upstream ENSMUSE00000249041 Chr13:81553573..81553690 TGGCATCATAGGCTTCAGTG Chr13:81553655..81553674 59.82 50
upstream ENSMUSE00000249031 Chr13:81552046..81552217 AGATGAACTCCGGTTTGTGG Chr13:81552114..81552133 59.97 50
upstream ENSMUSE00000249019 Chr13:81544163..81544405 CTGCAGGGGCAGCTATAAAC Chr13:81544340..81544359 59.87 55
upstream ENSMUSE00000249007 Chr13:81536166..81536573 TGGTCGGGTCCTCATATCTC Chr13:81536531..81536550 59.89 55
upstream ENSMUSE00000248998 Chr13:81530615..81530799 TTAACCCAAAGCGCAAAGAC Chr13:81530704..81530723 60.24 45
upstream ENSMUSE00000248990 Chr13:81525711..81525960 GGCTACTGGATGTCCCTGAG Chr13:81525819..81525838 59.68 60
upstream ENSMUSE00000248983 Chr13:81524887..81525026 TCAGAGTGCACAACCTCTGC Chr13:81524984..81525003 60.19 55
upstream ENSMUSE00000248975 Chr13:81521219..81521379 TGTCTACGCCCAGACTGACA Chr13:81521273..81521292 60.46 55
upstream ENSMUSE00000248966 Chr13:81513181..81513281 TTTGCTTGGCTGTTGTTTCA Chr13:81513259..81513278 60.42 40
upstream ENSMUSE00000640942 Chr13:81422355..81422471 TGTGGCGCATTACCTGTATC Chr13:81422384..81422403 59.57 50
upstream ENSMUSE00000640940 Chr13:81409743..81409921 GAGTGATGAGCACACGGAGA Chr13:81409873..81409892 59.99 55
upstream ENSMUSE00000248941 Chr13:81321645..81321802 TAATGTGCCTCGTGGTGGTA Chr13:81321730..81321749 59.99 50
upstream ENSMUSE00000248936 Chr13:81294154..81294275 GGACTGCATATGGCCTACAGA Chr13:81294199..81294219 60.11 52.38
upstream ENSMUSE00000248930 Chr13:81245902..81246090 AAATGAATGGTCACCCAGGA Chr13:81245995..81246014 60.17 45

*** Putative Vector Insertion (Chr 13: 81245901 - 81294276) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248923 Chr13:81242218..81242395 TGGGACTCTTCATCGGCTAT Chr13:81242231..81242250 59.65 50
downstream ENSMUSE00000640939 Chr13:81234067..81234500 TGGCTTCCTTGACCAGATTC Chr13:81234433..81234452 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTCATTAATCGCCTTGCAG Chr13:81255211..81255232 60.35 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTCTTGCTCTTCATCGTG Chr13:81255221..81255241 60.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069170