Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38473
Trapped Gene
Kirrel3 (ENSMUSG00000032036)
Vector Insertion
Chr 9: 34296744 - 34712497
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701842 (Chr9:34296689..34296743 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCTGGATTTGCTCTTCCT Chr9:34296701..34296720 59.57 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701842 (Chr9:34296689..34296743 +)
Downstram Exon
ENSMUSE00000701819 (Chr9:34712498..34712610 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCTGGATTTGCTCTTCCT Chr9:34296701..34296720 59.57 50 AGGTCAGCATGGAGGCATAA Chr9:34712591..34712610 60.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701842 Chr9:34296689..34296743 CAGCTGGATTTGCTCTTCCT Chr9:34296701..34296720 59.57 50

*** Putative Vector Insertion (Chr 9: 34296744 - 34712497) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000537112 Chr9:34712494..34712610 AGGTCAGCATGGAGGCATAA Chr9:34712591..34712610 60.62 50
downstream ENSMUSE00000701819 Chr9:34712498..34712610 AGGTCAGCATGGAGGCATAA Chr9:34712591..34712610 60.62 50
downstream ENSMUSE00000451881 Chr9:34719369..34719446 TCTCCGAAACTTGTCCTTGG Chr9:34719439..34719458 60.22 50
downstream ENSMUSE00000537111 Chr9:34719369..34719446 TCTCCGAAACTTGTCCTTGG Chr9:34719439..34719458 60.22 50
downstream ENSMUSE00000711295 Chr9:34719369..34719446 TCTCCGAAACTTGTCCTTGG Chr9:34719439..34719458 60.22 50
downstream ENSMUSE00000638026 Chr9:34746697..34746846 AGCCATCTTTGATCCACAGG Chr9:34746819..34746838 60.07 50
downstream ENSMUSE00000638025 Chr9:34751955..34752104 GCACTCATACACGGCATCAT Chr9:34752055..34752074 59.56 50
downstream ENSMUSE00000638024 Chr9:34798520..34798677 GTGGCTCCATTGATGACCTC Chr9:34798670..34798689 60.48 55
downstream ENSMUSE00000701814 Chr9:34798520..34798719 CAGGCTCACCTTGGAGTAGG Chr9:34798689..34798708 59.86 60
downstream ENSMUSE00000638022 Chr9:34808440..34808590 GGCTCGGCACACAATACTCT Chr9:34808538..34808557 60.28 55
downstream ENSMUSE00000638021 Chr9:34815278..34815383 TCCACGGACAAGTTGACAAG Chr9:34815308..34815327 59.72 50
downstream ENSMUSE00000638020 Chr9:34820853..34821001 CCACCGTGGTCCTATACAGC Chr9:34820917..34820936 60.4 60
downstream ENSMUSE00000638019 Chr9:34822840..34822967 CATCCACACGATGGTCAGAG Chr9:34822952..34822971 60.11 55
downstream ENSMUSE00000638018 Chr9:34824007..34824133 GCGGACAGATTTGAGGGTTA Chr9:34824051..34824070 60.07 50
downstream ENSMUSE00000638017 Chr9:34827676..34827776 CTCCGGATGAAGCATTTGAT Chr9:34827757..34827776 60.04 45
downstream ENSMUSE00000638016 Chr9:34831039..34831237 GCACGCACAATGTTGCTAAT Chr9:34831160..34831179 59.76 45
downstream ENSMUSE00000231250 Chr9:34832696..34832731 No primer for this exon
downstream ENSMUSE00000638015 Chr9:34835917..34836024 GTTGCCATTAGGACGAGGAA Chr9:34835992..34836011 60.07 50
downstream ENSMUSE00000701821 Chr9:34835917..34836099 GTTGCCATTAGGACGAGGAA Chr9:34835992..34836011 60.07 50
downstream ENSMUSE00000638014 Chr9:34837359..34837468 TATGGTGGTGTGGTCCTCAG Chr9:34837459..34837478 59.39 55
downstream ENSMUSE00000638013 Chr9:34841787..34841873 GCACCGAGTCTTGTTGGAAT Chr9:34841823..34841842 60.12 50
downstream ENSMUSE00000451766 Chr9:34842422..34844301 TCAGACGTGAGTCTGCATCC Chr9:34842868..34842887 59.99 55
downstream ENSMUSE00000488723 Chr9:34842422..34843889 TCAGACGTGAGTCTGCATCC Chr9:34842868..34842887 59.99 55
downstream ENSMUSE00000701822 Chr9:34842422..34842865 TCAGACGTGAGTCTGCATCC Chr9:34842868..34842887 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACAGAATTGCATTGTTTGG Chr9:34602772..34602793 60.36 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACATTCGTGACTGGGAAAA Chr9:34602789..34602809 59.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032036