Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38494
Trapped Gene
Mybbp1a (ENSMUSG00000040463)
Vector Insertion
Chr 11: 72255078 - 72255179
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314731 (Chr11:72254871..72255077 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCTGGGACATTGCGAAAC Chr11:72254993..72255012 60.64 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314731 (Chr11:72254871..72255077 +)
Downstram Exon
ENSMUSE00000314726 (Chr11:72255180..72255275 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCTGGGACATTGCGAAAC Chr11:72254993..72255012 60.64 50 CCAGTGATTAGGCGCTTCAG Chr11:72255223..72255242 60.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000314731 Chr11:72254871..72255077 CTTCTGGGACATTGCGAAAC Chr11:72254993..72255012 60.64 50

*** Putative Vector Insertion (Chr 11: 72255078 - 72255179) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000314726 Chr11:72255180..72255275 CCAGTGATTAGGCGCTTCAG Chr11:72255223..72255242 60.92 55
downstream ENSMUSE00000314717 Chr11:72255902..72255985 TCTGATCCAGGATGTCACACA Chr11:72255952..72255972 60.1 47.62
downstream ENSMUSE00000314708 Chr11:72256072..72256146 AGCACTCCAAAAAGGTTTGC Chr11:72256118..72256137 59.36 45
downstream ENSMUSE00000314699 Chr11:72256248..72256355 GTAAGTGGTTGGGGTGTTGG Chr11:72256317..72256336 60.13 55
downstream ENSMUSE00000314692 Chr11:72256978..72257153 AGAGCGGAGGATCACTTTCA Chr11:72257052..72257071 59.95 50
downstream ENSMUSE00000314685 Chr11:72257243..72257410 GTCCAGGACGGATTCTTCAG Chr11:72257407..72257426 59.65 55
downstream ENSMUSE00000314676 Chr11:72257505..72257622 CAAAATGGCGGATCAAGTCT Chr11:72257602..72257621 60.07 45
downstream ENSMUSE00000314669 Chr11:72258184..72258479 CGTCCTGAGCTCTCTTCTGG Chr11:72258469..72258488 60.28 60
downstream ENSMUSE00000651079 Chr11:72258184..72258332 TAGTCAACTGCCGCTTAGGG Chr11:72258280..72258299 60.4 55
downstream ENSMUSE00000314661 Chr11:72258678..72258788 TGGCTATTTGCTCAACCACA Chr11:72258790..72258809 60.26 45
downstream ENSMUSE00000314654 Chr11:72259110..72259235 CTGCTTCGTCTCTGGGATCT Chr11:72259179..72259198 59.56 55
downstream ENSMUSE00000314650 Chr11:72259396..72259563 CAACAGCATGTCTGCCAACT Chr11:72259501..72259520 59.9 50
downstream ENSMUSE00000314643 Chr11:72259660..72259759 CGGGCCTCTAATTCCTTCAG Chr11:72259695..72259714 61.07 55
downstream ENSMUSE00000314637 Chr11:72260474..72260570 TCTGCTCCATGCTTTTCTTG Chr11:72260543..72260562 59.15 45
downstream ENSMUSE00000392037 Chr11:72260651..72260802 AATACACTCCGGACCACCTG Chr11:72260753..72260772 59.84 55
downstream ENSMUSE00000314631 Chr11:72261055..72261141 ATCAGCGTCATCAGTGACCA Chr11:72261120..72261139 60.28 50
downstream ENSMUSE00000314626 Chr11:72261232..72261384 TCACGGTCCTCCTCTTCACT Chr11:72261323..72261342 59.83 55
downstream ENSMUSE00000314620 Chr11:72261458..72261628 ATGCGCATCTTCTGCTCTTT Chr11:72261561..72261580 60.12 45
downstream ENSMUSE00000314612 Chr11:72261719..72261879 CTGGATCACGTTCAGCAGTG Chr11:72261811..72261830 60.46 55
downstream ENSMUSE00000314603 Chr11:72262234..72262465 AGGACTCGCAGCAGGTACAG Chr11:72262398..72262417 60.61 60
downstream ENSMUSE00000314592 Chr11:72262545..72262676 ACATGGGGACCGTAAGTGAG Chr11:72262653..72262672 59.84 55
downstream ENSMUSE00000676966 Chr11:72262658..72262676 No primer for this exon
downstream ENSMUSE00000314580 Chr11:72262763..72262831 ACGGGAAGCAGGTTCTTACA Chr11:72262791..72262810 59.73 50
downstream ENSMUSE00000314569 Chr11:72263222..72263335 GACTCTCAGCTCTCGTGCAG Chr11:72263278..72263297 59.02 60
downstream ENSMUSE00000314559 Chr11:72263495..72263596 TGTTCAGCAGCTCCAAGATG Chr11:72263573..72263592 60.14 50
downstream ENSMUSE00000314554 Chr11:72264128..72264276 CTTTGCTGCAGCTTCTGTTG Chr11:72264198..72264217 59.93 50
downstream ENSMUSE00000386413 Chr11:72264379..72265050 TGTGACGCAGCATTCTTTTC Chr11:72264540..72264559 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACGGAGAAGTTGTTGGAG Chr11:72255038..72255058 60.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACGGAGAAGTTGTTGGAG Chr11:72255038..72255058 60.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040463