Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI385
Trapped Gene
1700007B14Rik (ENSMUSG00000031620)
Vector Insertion
Chr 8: 78508090 - 78508378
Public Clones GC1245 (tigem) CMHD-GT_199E10-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711509 (Chr8:78508091..78508402 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGTTTGGATGAGCGGTCTTT Chr8:78508350..78508370 60.12 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711509 (Chr8:78508091..78508402 +)
Downstram Exon
ENSMUSE00000357281 (Chr8:78508091..78508377 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGTTTGGATGAGCGGTCTTT Chr8:78508350..78508370 60.12 42.86 TATGGATCGAGCCACCAACT Chr8:78508161..78508180 60.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682106 Chr8:77972690..77972905 CCTGGTAGGGCAACTGTGAT Chr8:77972767..77972786 59.99 55
upstream ENSMUSE00000713591 Chr8:77972882..77972905 No primer for this exon
upstream ENSMUSE00000715260 Chr8:77986508..77986625 ATAGGCGCAGAAAGAGCTTG Chr8:77986560..77986579 59.75 50
upstream ENSMUSE00000710302 Chr8:77989764..77989789 CCCTGACTCTTACCATCACCTC Chr8:77989764..77989785 59.99 54.54
upstream ENSMUSE00000682105 Chr8:78078742..78078823 TGGCACCTGCAGAAGCTATAC Chr8:78078791..78078811 60.42 52.38
upstream ENSMUSE00000708783 Chr8:78078742..78078823 TGGCACCTGCAGAAGCTATAC Chr8:78078791..78078811 60.42 52.38
upstream ENSMUSE00000380983 Chr8:78099772..78099854 TTGCCCAACATCACAAGAGA Chr8:78099826..78099845 60.24 45
upstream ENSMUSE00000250852 Chr8:78101629..78101893 GGAGCCACATGTGTCGAATA Chr8:78101835..78101854 59.53 50
upstream ENSMUSE00000391111 Chr8:78148920..78149010 TCCGTGAGTAAGCAAATGGA Chr8:78148958..78148977 59.27 45
upstream ENSMUSE00000211189 Chr8:78153613..78153692 TTCCATTCCCACATGAGCTT Chr8:78153626..78153645 60.46 45
upstream ENSMUSE00000211193 Chr8:78193283..78193398 CAGGACGCTTTATGATTGGA Chr8:78193287..78193306 58.72 45
upstream ENSMUSE00000211192 Chr8:78238669..78238727 No primer for this exon
upstream ENSMUSE00000211190 Chr8:78270162..78270357 TTGAGCGCAAAAGACTTCAA Chr8:78270323..78270342 59.73 40
upstream ENSMUSE00000211187 Chr8:78277239..78277383 TTTCGTATCATGGGCCAAAT Chr8:78277240..78277259 60.15 40
upstream ENSMUSE00000211191 Chr8:78286874..78287008 CCAGACCCAGATCGATGAGT Chr8:78286968..78286987 60.07 55
upstream ENSMUSE00000250815 Chr8:78412396..78412557 CTCCTCAAGGTGCCAGAGTG Chr8:78412465..78412484 61 60

*** Putative Vector Insertion (Chr 8: 78508090 - 78508378) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000357281 Chr8:78508091..78508377 TATGGATCGAGCCACCAACT Chr8:78508161..78508180 60.48 50
downstream ENSMUSE00000711509 Chr8:78508091..78508402 TATGGATCGAGCCACCAACT Chr8:78508161..78508180 60.48 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAATAATCGCCTTGCAGCAC Chr8:78508138..78508158 61.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACTGTTGGCAACGTGACT Chr8:78508128..78508148 61.18 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031620