Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38501
Trapped Gene
Kif15 (ENSMUSG00000036768)
Vector Insertion
Chr 9: 122897142 - 122900203
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254783 (Chr9:122896964..122897141 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGAAATCGATGCCCAGTCT Chr9:122897064..122897083 59.51 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254783 (Chr9:122896964..122897141 +)
Downstram Exon
ENSMUSE00000254769 (Chr9:122900204..122900345 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGAAATCGATGCCCAGTCT Chr9:122897064..122897083 59.51 45 TGAATTTGCAGGAGTTGTGC Chr9:122900294..122900313 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000528048 Chr9:122860182..122860270 AAGGGAGGATTCTGGTGGTC Chr9:122860201..122860220 60.31 55
upstream ENSMUSE00000404489 Chr9:122868235..122868277 No primer for this exon
upstream ENSMUSE00000359842 Chr9:122868925..122869108 ACTCTCCGGCTACACTCCAA Chr9:122869034..122869053 59.87 55
upstream ENSMUSE00000528047 Chr9:122872598..122872674 AAAAGCATTGTGGAATCATGC Chr9:122872622..122872642 59.96 38.1
upstream ENSMUSE00000528046 Chr9:122875067..122875104 CAGACTGGCTCTGGGAAGAC Chr9:122875071..122875090 59.99 60
upstream ENSMUSE00000220698 Chr9:122880807..122880904 No primer for this exon
upstream ENSMUSE00000254867 Chr9:122884767..122884946 GGAGCTGGGAAGAGTTTCCT Chr9:122884770..122884789 59.82 55
upstream ENSMUSE00000412405 Chr9:122886958..122887167 CATCCGGACCTCCTTACTCA Chr9:122887083..122887102 60.06 55
upstream ENSMUSE00000335709 Chr9:122888588..122888713 ATAAACCGATCGCTGAGCTG Chr9:122888600..122888619 60.37 50
upstream ENSMUSE00000409812 Chr9:122888858..122888980 TTTTGCTCAAAGAGCCAAGC Chr9:122888947..122888966 60.64 45
upstream ENSMUSE00000393841 Chr9:122893918..122894041 GAAATGTCAGCCAACTGCAA Chr9:122893943..122893962 59.85 45
upstream ENSMUSE00000345735 Chr9:122895263..122895339 No primer for this exon
upstream ENSMUSE00000386576 Chr9:122895560..122895769 GAGGACCAAATCATGCGTCT Chr9:122895650..122895669 60.08 50
upstream ENSMUSE00000254783 Chr9:122896964..122897141 ATGAAATCGATGCCCAGTCT Chr9:122897064..122897083 59.51 45

*** Putative Vector Insertion (Chr 9: 122897142 - 122900203) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254769 Chr9:122900204..122900345 TGAATTTGCAGGAGTTGTGC Chr9:122900294..122900313 59.85 45
downstream ENSMUSE00000254747 Chr9:122900979..122901120 TTTTGTTGCCTCCAAAAGGT Chr9:122901066..122901085 59.59 40
downstream ENSMUSE00000254728 Chr9:122902961..122903158 GCACAGTTCGAAGCTCCTCT Chr9:122903159..122903178 59.75 55
downstream ENSMUSE00000396286 Chr9:122904834..122904941 CGTTCTTCTTCATCCAGCTTC Chr9:122904879..122904899 59.07 47.62
downstream ENSMUSE00000383048 Chr9:122905409..122905514 TGGTCCAATCGCTTCTTTCT Chr9:122905442..122905461 59.81 45
downstream ENSMUSE00000335687 Chr9:122906900..122907065 CAGGTCATGCACCTCACATT Chr9:122906928..122906947 59.55 50
downstream ENSMUSE00000254648 Chr9:122908293..122908443 GGCTTGGCTCTCAAGAAGTTT Chr9:122908328..122908348 60.01 47.62
downstream ENSMUSE00000254623 Chr9:122908633..122908718 GCTTCAAAAAGCTCCACCAA Chr9:122908658..122908677 60.37 45
downstream ENSMUSE00000254601 Chr9:122910163..122910232 CTTTTCACACTTGGCCATCTC Chr9:122910231..122910251 59.73 47.62
downstream ENSMUSE00000254586 Chr9:122911153..122911239 No primer for this exon
downstream ENSMUSE00000254567 Chr9:122912688..122912792 TTCAGGGTGGCTATGGTTTC Chr9:122912773..122912792 59.93 50
downstream ENSMUSE00000254552 Chr9:122913689..122913811 CTTTGTCAGCCAATGAAGCA Chr9:122913722..122913741 59.99 45
downstream ENSMUSE00000405378 Chr9:122916432..122916578 CTGGTCAGCTCCTCTTGAGC Chr9:122916547..122916566 60.28 60
downstream ENSMUSE00000254487 Chr9:122918435..122918536 TTCTGCTCCACTTCCTCCTT Chr9:122918469..122918488 59.01 50
downstream ENSMUSE00000254476 Chr9:122918878..122919042 TTGAAAATGGGGTGGTGTTT Chr9:122918907..122918926 60.07 40
downstream ENSMUSE00000254448 Chr9:122920646..122920755 TTGCAGGAGCCAGTTTTTCT Chr9:122920720..122920739 59.99 45
downstream ENSMUSE00000254420 Chr9:122923058..122923130 No primer for this exon
downstream ENSMUSE00000254401 Chr9:122923587..122923624 No primer for this exon
downstream ENSMUSE00000254380 Chr9:122926363..122926528 TCTGGTTCGCTCAATTTCCT Chr9:122926444..122926463 59.81 45
downstream ENSMUSE00000254350 Chr9:122926705..122926836 TTGCTTTTTCAGCATTTCCA Chr9:122926731..122926750 59.42 35
downstream ENSMUSE00000254326 Chr9:122927186..122927843 TTCAGCACGCAATTTTTCTG Chr9:122927212..122927231 59.99 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAAAAGCTTTCGCTGAAGTGT Chr9:122900097..122900119 60.06 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAAAGCTTTCGCTGAAGTGT Chr9:122900097..122900119 60.06 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036768