Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38504
Trapped Gene
Fcnb (ENSMUSG00000026835)
Vector Insertion
Chr 2: 27938425 - 27940399
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000349734 (Chr2:27940311..27940398 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000349734 (Chr2:27940311..27940398 -)
Downstram Exon
ENSMUSE00000163326 (Chr2:27938426..27938539 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349734 Chr2:27940311..27940398 No primer for this exon
upstream ENSMUSE00000716176 Chr2:27940311..27940405 No primer for this exon
upstream ENSMUSE00000163326 Chr2:27938426..27938539 No primer for this exon

*** Putative Vector Insertion (Chr 2: 27938425 - 27940399) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000163319 Chr2:27936416..27936469 No primer for this exon
downstream ENSMUSE00000163328 Chr2:27936106..27936141 No primer for this exon
downstream ENSMUSE00000163320 Chr2:27935421..27935453 No primer for this exon
downstream ENSMUSE00000163324 Chr2:27935142..27935269 No primer for this exon
downstream ENSMUSE00000163322 Chr2:27934642..27934771 No primer for this exon
downstream ENSMUSE00000163318 Chr2:27933767..27933901 No primer for this exon
downstream ENSMUSE00000718527 Chr2:27933619..27933901 No primer for this exon
downstream ENSMUSE00000369003 Chr2:27931999..27932342 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGGGATCTGCTGCACTAT Chr2:27940351..27940371 60.24 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGGGATCTGCTGCACTAT Chr2:27940351..27940371 60.24 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026835