Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38505
Trapped Gene
Astn2 (ENSMUSG00000028373)
Vector Insertion
Chr 4: 65611160 - 65653469
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000526579 (Chr4:65653322..65653468 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTGTGGCAACCAGATGTC Chr4:65653378..65653397 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000526579 (Chr4:65653322..65653468 -)
Downstram Exon
ENSMUSE00000632313 (Chr4:65611161..65611328 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTGTGGCAACCAGATGTC Chr4:65653378..65653397 60.01 55 ACAGGCATCTGTCGTCCTCT Chr4:65611164..65611183 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000526558 Chr4:66065635..66065656 No primer for this exon
upstream ENSMUSE00000446886 Chr4:66064917..66065517 AAGACCGTCACCGTATCCAC Chr4:66065171..66065190 59.85 55
upstream ENSMUSE00000526557 Chr4:66064917..66065429 AAGACCGTCACCGTATCCAC Chr4:66065171..66065190 59.85 55
upstream ENSMUSE00000526590 Chr4:65927227..65927414 ACAGCAGCGGACATTTCTTT Chr4:65927384..65927403 59.88 45
upstream ENSMUSE00000526587 Chr4:65846158..65846542 TCTCCCGTGAGGATGAGTTT Chr4:65846231..65846250 59.65 50
upstream ENSMUSE00000526585 Chr4:65780091..65780246 TCAAGGAGAGTTTCCGTGCT Chr4:65780179..65780198 59.99 50
upstream ENSMUSE00000526582 Chr4:65720164..65720271 CACAGAGCAGTACCGCAGTC Chr4:65720179..65720198 59.65 60
upstream ENSMUSE00000526579 Chr4:65653322..65653468 GTGTGTGGCAACCAGATGTC Chr4:65653378..65653397 60.01 55
upstream ENSMUSE00000632313 Chr4:65611161..65611328 TGGACAGAGGACGACAGATG Chr4:65611191..65611210 59.82 55

*** Putative Vector Insertion (Chr 4: 65611160 - 65653469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000632312 Chr4:65574747..65574831 GATGTCTGTGGACTGGGTCA Chr4:65574759..65574778 59.5 55
downstream ENSMUSE00000632311 Chr4:65573595..65573669 AATCTTTTCAGGGGCTTGCT Chr4:65573578..65573597 60.21 45
downstream ENSMUSE00000330503 Chr4:65572694..65572831 CTTCTGTGACGAGCACATCC Chr4:65572688..65572707 59.42 55
downstream ENSMUSE00000632291 Chr4:65572694..65572819 CTTCTGTGACGAGCACATCC Chr4:65572688..65572707 59.42 55
downstream ENSMUSE00000632310 Chr4:65455513..65455663 CGTTGTTCCTTGAGCAGTCA Chr4:65455553..65455572 60.03 50
downstream ENSMUSE00000632309 Chr4:65407333..65407499 CATAGGGCAAAGGCAGTGTT Chr4:65407345..65407364 60.13 50
downstream ENSMUSE00000632308 Chr4:65390355..65390543 TGTGTCCGGTTGTTGTAACC Chr4:65390372..65390391 59.31 50
downstream ENSMUSE00000632306 Chr4:65312897..65313021 ATCTGCCAGCTGTGGAAAGT Chr4:65312960..65312979 59.87 50
downstream ENSMUSE00000632305 Chr4:65309289..65309393 TAGAGATTGCTCCGGACACG Chr4:65309302..65309321 61.34 55
downstream ENSMUSE00000603751 Chr4:65305732..65305911 TCATCCCGACTGCTCTCTTT Chr4:65305841..65305860 59.95 50
downstream ENSMUSE00000603750 Chr4:65242574..65242839 CACACGGTTTATCTCCAGCA Chr4:65242594..65242613 59.72 50
downstream ENSMUSE00000603749 Chr4:65203685..65203818 ACACCTGCACCAGTCATCAA Chr4:65203722..65203741 60.16 50
downstream ENSMUSE00000672893 Chr4:65201973..65202121 GGCTCCACTGTTGGAGAAAG Chr4:65202073..65202092 59.84 55
downstream ENSMUSE00000632299 Chr4:65096186..65096327 CATCGGCAAAACTCAGGAAT Chr4:65096282..65096301 60.07 45
downstream ENSMUSE00000632298 Chr4:65057992..65058092 CCCTCGAGTATCCACAGCAT Chr4:65058040..65058059 60.1 55
downstream ENSMUSE00000632297 Chr4:65056105..65056288 CCTCACTCCTCCAGACGAAG Chr4:65056099..65056118 59.98 60
downstream ENSMUSE00000475903 Chr4:65041837..65042723 GGATGTAGGCGCTTCTCAAG Chr4:65042625..65042644 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGAGCTTCCCAGTAATCG Chr4:65626412..65626432 59.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTACGTGACTGGGAAAACC Chr4:65626402..65626423 58.83 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028373