Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38516
Trapped Gene
Arhgap17 (ENSMUSG00000030766)
Vector Insertion
Chr 7: 130467126 - 130470858
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000632587 (Chr7:130470753..130470857 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGACACTGTGCGTTCAAT Chr7:130470826..130470845 59.75 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000632587 (Chr7:130470753..130470857 -)
Downstram Exon
ENSMUSE00000632586 (Chr7:130467127..130467200 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGACACTGTGCGTTCAAT Chr7:130470826..130470845 59.75 50 GGCAAGAGCTGTCAGAGGAA Chr7:130467152..130467171 60.68 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669939 Chr7:130513268..130513392 GTAGGTAGGACCCGCCAGAC Chr7:130513373..130513392 60.9 65
upstream ENSMUSE00000669962 Chr7:130513268..130513405 GTAGGTAGGACCCGCCAGAC Chr7:130513373..130513392 60.9 65
upstream ENSMUSE00000632588 Chr7:130474740..130474779 AGCTGAGAAGACCGAAGTCC Chr7:130474760..130474779 58.62 55
upstream ENSMUSE00000632587 Chr7:130470753..130470857 CTGGACACTGTGCGTTCAAT Chr7:130470826..130470845 59.75 50
upstream ENSMUSE00000632586 Chr7:130467127..130467200 AGAACATGCAGGAGGCTTCA Chr7:130467153..130467172 60.94 50

*** Putative Vector Insertion (Chr 7: 130467126 - 130470858) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000632585 Chr7:130465393..130465504 TATGCCGTAGAGAGGGTCCA Chr7:130465377..130465396 60.62 55
downstream ENSMUSE00000632584 Chr7:130465102..130465178 CTGAATCCCAGTCCAACACC Chr7:130465090..130465109 60.36 55
downstream ENSMUSE00000632583 Chr7:130461901..130462012 CCCTGAAAGTTGGTTCCTGA Chr7:130461949..130461968 60.08 50
downstream ENSMUSE00000632582 Chr7:130458158..130458226 TGCCATACTCCCCTTCTTTG Chr7:130458150..130458169 60.07 50
downstream ENSMUSE00000632580 Chr7:130457928..130458009 TGGTAATCTGCTTGGGCTTC Chr7:130457962..130457981 60.21 50
downstream ENSMUSE00000632579 Chr7:130451800..130451927 CCTCTTTCATGCCAGTCTCC Chr7:130451780..130451799 59.8 55
downstream ENSMUSE00000632578 Chr7:130450482..130450593 GACAGCATGGGGATCAGAAT Chr7:130450464..130450483 59.89 50
downstream ENSMUSE00000632577 Chr7:130449889..130449970 CAACTCCCGCAGATAGGACT Chr7:130449920..130449939 59.31 55
downstream ENSMUSE00000632576 Chr7:130447210..130447290 No primer for this exon
downstream ENSMUSE00000632575 Chr7:130444003..130444116 CAGGACAATGGCTATGTTGC Chr7:130444013..130444032 59.15 50
downstream ENSMUSE00000632574 Chr7:130441009..130441100 GATGATGGGCTCAATCACTG Chr7:130441015..130441034 59.04 50
downstream ENSMUSE00000632573 Chr7:130439924..130440080 TCCCCGAGTCAGAGTCATTT Chr7:130439966..130439985 59.65 50
downstream ENSMUSE00000202967 Chr7:130437986..130438219 GCTCCAATATGCCCGTAGAA Chr7:130437989..130438008 60.06 50
downstream ENSMUSE00000632572 Chr7:130435550..130435719 CTGCACTGTGAGGTGTGCTT Chr7:130435558..130435577 60.1 55
downstream ENSMUSE00000632592 Chr7:130430130..130430527 GGTCTCACTTTGCGATGGAT Chr7:130430141..130430160 60.08 50
downstream ENSMUSE00000632591 Chr7:130430096..130430128 No primer for this exon
downstream ENSMUSE00000632590 Chr7:130430013..130430093 GATGTAAGGCCACCATCCAC Chr7:130430022..130430041 60.2 55
downstream ENSMUSE00000632571 Chr7:130430012..130430527 GGTCTCACTTTGCGATGGAT Chr7:130430141..130430160 60.08 50
downstream ENSMUSE00000669935 Chr7:130429816..130429820 No primer for this exon
downstream ENSMUSE00000669938 Chr7:130428934..130428981 GAAACCTTCCCCACCTGTGA Chr7:130428922..130428941 62.25 55
downstream ENSMUSE00000669936 Chr7:130422789..130423630 TTGCTTGCCAAGTCTGAATG Chr7:130423539..130423558 59.99 45
downstream ENSMUSE00000632570 Chr7:130422785..130423630 TTGCTTGCCAAGTCTGAATG Chr7:130423539..130423558 59.99 45
downstream ENSMUSE00000669940 Chr7:130350805..130350818 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr7:130470789..130470809 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATGTGCCACCATTCACAT Chr7:130467808..130467828 60.25 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030766