Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38536
Trapped Gene
Cbfb (ENSMUSG00000031885)
Vector Insertion
Chr 8: 107726479 - 107739803
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680120 (Chr8:107726352..107726478 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCTCGAAGAAGAACTCG Chr8:107726385..107726404 59.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680120 (Chr8:107726352..107726478 +)
Downstram Exon
ENSMUSE00000680118 (Chr8:107739804..107741886 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCTCGAAGAAGAACTCG Chr8:107726385..107726404 59.31 55 AAAGCCTGCACTACCGAAGA Chr8:107741700..107741719 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000365768 Chr8:107694574..107694953 GCAAGTTCGAGAACGAGGAG Chr8:107694904..107694923 60.13 55
upstream ENSMUSE00000214257 Chr8:107695206..107695292 No primer for this exon
upstream ENSMUSE00000214256 Chr8:107702493..107702609 CAAACACCTAGCCGGGAATA Chr8:107702562..107702581 59.95 50
upstream ENSMUSE00000214252 Chr8:107718375..107718491 CTTGAAGGCTCCCATGATTC Chr8:107718380..107718399 59.63 50
upstream ENSMUSE00000237079 Chr8:107726352..107726447 GAGGCTCGAAGAAGAACTCG Chr8:107726385..107726404 59.31 55
upstream ENSMUSE00000680120 Chr8:107726352..107726478 GAGGCTCGAAGAAGAACTCG Chr8:107726385..107726404 59.31 55

*** Putative Vector Insertion (Chr 8: 107726479 - 107739803) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000370080 Chr8:107739804..107741886 AAAGCCTGCACTACCGAAGA Chr8:107741700..107741719 60.01 50
downstream ENSMUSE00000680118 Chr8:107739804..107741886 AAAGCCTGCACTACCGAAGA Chr8:107741700..107741719 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTATAATCGCCTTGCAGCAC Chr8:107735527..107735547 58.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTTCGTGACTGGGAAAACC Chr8:107729525..107729546 60.87 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031885