Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38549
Trapped Gene
Lpar2 (ENSMUSG00000031861)
Vector Insertion
Chr 8: 72346611 - 72347461
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000389931 (Chr8:72346328..72346610 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGGGTCTCAGTCCTGCTT Chr8:72346544..72346563 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000389931 (Chr8:72346328..72346610 +)
Downstram Exon
ENSMUSE00000506468 (Chr8:72347462..72347734 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGGGTCTCAGTCCTGCTT Chr8:72346544..72346563 60.26 55 GCCGATGGTCTCGTTGTAGT Chr8:72347497..72347516 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000389931 Chr8:72346328..72346610 CATGGGTCTCAGTCCTGCTT Chr8:72346544..72346563 60.26 55

*** Putative Vector Insertion (Chr 8: 72346611 - 72347461) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000479851 Chr8:72347453..72348194 TGCCAGAAGTGTGCAGGTAG Chr8:72347964..72347983 60.05 55
downstream ENSMUSE00000506468 Chr8:72347462..72347734 GCCGATGGTCTCGTTGTAGT Chr8:72347497..72347516 60.14 55
downstream ENSMUSE00000511789 Chr8:72347737..72347823 GAACCAGCCTTTGATGGAGA Chr8:72347770..72347789 60.19 50
downstream ENSMUSE00000510777 Chr8:72347825..72348194 TGCCAGAAGTGTGCAGGTAG Chr8:72347964..72347983 60.05 55
downstream ENSMUSE00000470665 Chr8:72350190..72355000 AACGTGGGAGTGACCTCAAC Chr8:72354128..72354147 60.01 55
downstream ENSMUSE00000706482 Chr8:72350190..72350503 AGTAACGGGCAGACTTGTGG Chr8:72350426..72350445 60.17 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr8:72346659..72346679 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGATGTGCAGGTAAGACCA Chr8:72346601..72346621 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031861