Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38569
Trapped Gene
Unc5c (ENSMUSG00000059921)
Vector Insertion
Chr 3: 141128802 - 141340950
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000487820 (Chr3:141128528..141128801 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCGGACTGGGACTAGGATA Chr3:141128711..141128730 60.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000487820 (Chr3:141128528..141128801 +)
Downstram Exon
ENSMUSE00000490941 (Chr3:141340951..141341172 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCGGACTGGGACTAGGATA Chr3:141128711..141128730 60.62 55 AGGTTTCTGGGAGTTCGTGA Chr3:141340986..141341005 59.7 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000487820 Chr3:141128528..141128801 TGCGGACTGGGACTAGGATA Chr3:141128711..141128730 60.62 55
upstream ENSMUSE00000669163 Chr3:141128538..141128801 TGCGGACTGGGACTAGGATA Chr3:141128711..141128730 60.62 55

*** Putative Vector Insertion (Chr 3: 141128802 - 141340950) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000490941 Chr3:141340951..141341172 AGGTTTCTGGGAGTTCGTGA Chr3:141340986..141341005 59.7 50
downstream ENSMUSE00000495594 Chr3:141377608..141377751 ATGCCTTCCGACTCTTCGTA Chr3:141377739..141377758 59.84 50
downstream ENSMUSE00000498177 Chr3:141396802..141396905 GGCCGACACTGGAGTAAGAC Chr3:141396883..141396902 59.73 60
downstream ENSMUSE00000500835 Chr3:141420678..141420858 AGTTCCGATCTTCAGCAGGA Chr3:141420732..141420751 59.95 50
downstream ENSMUSE00000562251 Chr3:141431408..141431575 GCAGGTTCTTGTGCGTTTCT Chr3:141431496..141431515 60.44 50
downstream ENSMUSE00000476357 Chr3:141433982..141434146 ACAGTCCTTACCCCCGTTCT Chr3:141434097..141434116 59.86 55
downstream ENSMUSE00000669162 Chr3:141449821..141449877 TGCTCAGTTGAAATGGGGTA Chr3:141449851..141449870 59.12 45
downstream ENSMUSE00000480782 Chr3:141451835..141452026 CCACGTAGAGAGCCACATCA Chr3:141451873..141451892 59.85 55
downstream ENSMUSE00000483396 Chr3:141452693..141453037 GTTGGGTAGTGGGTCCAGAA Chr3:141452823..141452842 59.82 55
downstream ENSMUSE00000512221 Chr3:141454756..141454843 TCATAGACTCTCCCCTGAGGAA Chr3:141454808..141454829 60.2 50
downstream ENSMUSE00000516753 Chr3:141464243..141464411 ACTGCCTGGTTTTTGAGCTG Chr3:141464398..141464417 60.43 50
downstream ENSMUSE00000519408 Chr3:141466684..141466917 GAGGATATGGCAAGCCTCTG Chr3:141466764..141466783 59.8 55
downstream ENSMUSE00000461689 Chr3:141479750..141479899 AATAGACAGGCGCAGGTTGT Chr3:141479851..141479870 59.76 50
downstream ENSMUSE00000464357 Chr3:141480995..141481159 GTGAAGGTGCAGTGGAGGTT Chr3:141481056..141481075 60.16 55
downstream ENSMUSE00000496677 Chr3:141490465..141490643 GCATAGCTTCTGCCGGATAG Chr3:141490575..141490594 59.97 55
downstream ENSMUSE00000562246 Chr3:141491371..141492433 ATCCAGGATTACGCCAGTTG Chr3:141491425..141491444 59.96 50
downstream ENSMUSE00000669164 Chr3:141491371..141497888 ACAGGGACCAACTCCACAAG Chr3:141492715..141492734 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCATTTGTTTATGCTTGCAG Chr3:141128809..141128830 59.89 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCATTTGTTTATGCTTGCAG Chr3:141128809..141128830 59.89 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059921