Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38570
Trapped Gene
Glt25d2 (ENSMUSG00000032649)
Vector Insertion
Chr 1: 154247528 - 154315578
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000437532 (Chr1:154247051..154247527 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000437532 (Chr1:154247051..154247527 +)
Downstram Exon
ENSMUSE00000377857 (Chr1:154315579..154315689 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000437532 Chr1:154247051..154247527 No primer for this exon

*** Putative Vector Insertion (Chr 1: 154247528 - 154315578) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000377857 Chr1:154315579..154315689 No primer for this exon
downstream ENSMUSE00000257974 Chr1:154318818..154318935 No primer for this exon
downstream ENSMUSE00000257969 Chr1:154320225..154320359 No primer for this exon
downstream ENSMUSE00000537824 Chr1:154331968..154332172 No primer for this exon
downstream ENSMUSE00000257953 Chr1:154336910..154337029 No primer for this exon
downstream ENSMUSE00000257949 Chr1:154342932..154343008 No primer for this exon
downstream ENSMUSE00000257940 Chr1:154347035..154347141 No primer for this exon
downstream ENSMUSE00000257933 Chr1:154350088..154350220 No primer for this exon
downstream ENSMUSE00000257925 Chr1:154351208..154351335 No primer for this exon
downstream ENSMUSE00000257917 Chr1:154353923..154354129 No primer for this exon
downstream ENSMUSE00000371730 Chr1:154355642..154357824 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTTGTAATCGCCTTGCAG Chr1:154262573..154262593 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACTTCGTGACTGGGAAAACC Chr1:154262574..154262595 59.09 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032649