Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38592
Trapped Gene
Spata2 (ENSMUSG00000047030)
Vector Insertion
Chr 2: 167310657 - 167318346
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000381161 (Chr2:167318259..167318345 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000381161 (Chr2:167318259..167318345 -)
Downstram Exon
ENSMUSE00000412169 (Chr2:167310658..167311093 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381161 Chr2:167318259..167318345 No primer for this exon
upstream ENSMUSE00000412169 Chr2:167310658..167311093 No primer for this exon
upstream ENSMUSE00000719777 Chr2:167310658..167311093 No primer for this exon

*** Putative Vector Insertion (Chr 2: 167310657 - 167318346) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679435 Chr2:167309198..167310079 No primer for this exon
downstream ENSMUSE00000367857 Chr2:167308850..167310079 No primer for this exon
downstream ENSMUSE00000679434 Chr2:167306933..167307058 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGGAGGCTGGCTTTAATC Chr2:167315290..167315310 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTCGTGACTGGGAAAAC Chr2:167315280..167315300 61.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047030