Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38598
Trapped Gene
Sft2d2 (ENSMUSG00000040848)
Vector Insertion
Chr 1: 167118378 - 167124452
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000229852 (Chr1:167124371..167124451 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCCTGACATGGACAAGCTG Chr1:167124422..167124441 61.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000229852 (Chr1:167124371..167124451 -)
Downstram Exon
ENSMUSE00000229846 (Chr1:167118379..167118465 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCCTGACATGGACAAGCTG Chr1:167124422..167124441 61.13 55 ACAGGATTCCCAGAGCAAAG Chr1:167118368..167118387 59.28 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000229852 Chr1:167124371..167124451 ACCCTGACATGGACAAGCTG Chr1:167124422..167124441 61.13 55
upstream ENSMUSE00000687912 Chr1:167124371..167124480 ACCCTGACATGGACAAGCTG Chr1:167124422..167124441 61.13 55
upstream ENSMUSE00000229846 Chr1:167118379..167118465 CTGGGGCACCAGAATAAAAG Chr1:167118423..167118442 59.56 50

*** Putative Vector Insertion (Chr 1: 167118378 - 167124452) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000229842 Chr1:167118100..167118185 GCACCCACAGCAGAAGAGTC Chr1:167118142..167118161 61.02 60
downstream ENSMUSE00000229837 Chr1:167115139..167115220 AGACGCGTAGGCTCAAACAT Chr1:167115139..167115158 59.9 50
downstream ENSMUSE00000229831 Chr1:167114101..167114136 No primer for this exon
downstream ENSMUSE00000229826 Chr1:167113958..167114013 GGCCAAAGACTGCAAAATACA Chr1:167113944..167113964 60.12 42.86
downstream ENSMUSE00000229822 Chr1:167112183..167112212 No primer for this exon
downstream ENSMUSE00000687909 Chr1:167109402..167109426 AAGCACTTCTTCACGGCATC Chr1:167109384..167109403 60.41 50
downstream ENSMUSE00000687908 Chr1:167108818..167109279 CACAGGCAACCCTCAAAAAT Chr1:167109218..167109237 59.97 45
downstream ENSMUSE00000358371 Chr1:167104628..167109426 ACTCGCAATTAACCGGTGTC Chr1:167108731..167108750 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAAGTTCTGAGCGGCCTAA Chr1:167118398..167118418 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGACATGGACAAGCTGAA Chr1:167118418..167118438 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040848