Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI386
Trapped Gene
Pcsk6 (ENSMUSG00000030513)
Vector Insertion
Chr 7: 73192556 - 73193791
Public Clones GC1311 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000264267 (Chr7:73192443..73192555 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGAGAACTGCCTGAGCTG Chr7:73192447..73192466 60.28 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000264267 (Chr7:73192443..73192555 +)
Downstram Exon
ENSMUSE00000402736 (Chr7:73193792..73195220 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGAGAACTGCCTGAGCTG Chr7:73192447..73192466 60.28 60 GTTTCGGAAGGAGCTGACTG Chr7:73194501..73194520 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512425 Chr7:73007099..73007329 CCCGTCTACACCAACCACTG Chr7:73007234..73007253 61.42 60
upstream ENSMUSE00000510369 Chr7:73055088..73055192 CCCACACCTTCCTCAGAATG Chr7:73055164..73055183 60.5 55
upstream ENSMUSE00000199998 Chr7:73072080..73072184 TGAAGCGCAGAGTCAAGAGA Chr7:73072105..73072124 60.01 50
upstream ENSMUSE00000673315 Chr7:73072113..73072184 TTTCAATGATCCCATTTGGTC Chr7:73072148..73072168 59.61 38.1
upstream ENSMUSE00000199990 Chr7:73072702..73072845 ATGTGGTCGTCACCATCCTC Chr7:73072781..73072800 60.82 55
upstream ENSMUSE00000673314 Chr7:73072702..73072845 ATGTGGTCGTCACCATCCTC Chr7:73072781..73072800 60.82 55
upstream ENSMUSE00000199980 Chr7:73073993..73074069 TATGACCCATCCCCGAGATA Chr7:73074029..73074048 60.11 50
upstream ENSMUSE00000673313 Chr7:73073993..73074069 TATGACCCATCCCCGAGATA Chr7:73074029..73074048 60.11 50
upstream ENSMUSE00000199984 Chr7:73076563..73076651 CTCGGCCAACAACTCCTACT Chr7:73076596..73076615 59.35 55
upstream ENSMUSE00000673312 Chr7:73076563..73076651 CTCGGCCAACAACTCCTACT Chr7:73076596..73076615 59.35 55
upstream ENSMUSE00000199995 Chr7:73097805..73097977 TGACATTTACAGCGCCAGTT Chr7:73097878..73097897 59.35 45
upstream ENSMUSE00000673310 Chr7:73097805..73097977 TGACATTTACAGCGCCAGTT Chr7:73097878..73097897 59.35 45
upstream ENSMUSE00000199996 Chr7:73103983..73104195 TCCTGTGATGGCTACACCAA Chr7:73104052..73104071 60.11 50
upstream ENSMUSE00000673309 Chr7:73103983..73104195 TCCTGTGATGGCTACACCAA Chr7:73104052..73104071 60.11 50
upstream ENSMUSE00000199986 Chr7:73107790..73107890 ATGGTGGCTGGTATCATTGC Chr7:73107853..73107872 60.75 50
upstream ENSMUSE00000673308 Chr7:73107790..73107890 ATGGTGGCTGGTATCATTGC Chr7:73107853..73107872 60.75 50
upstream ENSMUSE00000199987 Chr7:73113854..73113957 CACCTGCTGGTGAAGACATC Chr7:73113882..73113901 59.26 55
upstream ENSMUSE00000673307 Chr7:73113854..73113957 CACCTGCTGGTGAAGACATC Chr7:73113882..73113901 59.26 55
upstream ENSMUSE00000200005 Chr7:73115428..73115545 GTGGATGCAGAAGCTCTGGT Chr7:73115454..73115473 60.42 55
upstream ENSMUSE00000673306 Chr7:73115428..73115545 GTGGATGCAGAAGCTCTGGT Chr7:73115454..73115473 60.42 55
upstream ENSMUSE00000433616 Chr7:73125033..73125221 CCCTCTGGAACCAAGTCTCA Chr7:73125187..73125206 60.23 55
upstream ENSMUSE00000673305 Chr7:73125033..73125221 CCCTCTGGAACCAAGTCTCA Chr7:73125187..73125206 60.23 55
upstream ENSMUSE00000433653 Chr7:73128599..73128735 GTCCGAAACCCAGAGAAACA Chr7:73128714..73128733 60.09 50
upstream ENSMUSE00000673304 Chr7:73128599..73128735 GTCCGAAACCCAGAGAAACA Chr7:73128714..73128733 60.09 50
upstream ENSMUSE00000464622 Chr7:73170114..73170293 GCTGAAAGAATGGAGCCTCA Chr7:73170118..73170137 60.48 50
upstream ENSMUSE00000673303 Chr7:73170114..73170293 GCTGAAAGAATGGAGCCTCA Chr7:73170118..73170137 60.48 50
upstream ENSMUSE00000634290 Chr7:73170452..73170490 TCCATCCAAGGCTCTCCTAA Chr7:73170457..73170476 59.77 50
upstream ENSMUSE00000264314 Chr7:73176635..73176737 TGACAAAGGCTGTGATGGTC Chr7:73176657..73176676 59.68 50
upstream ENSMUSE00000264305 Chr7:73178636..73178832 CTGCCGGACTTTATGCTGAT Chr7:73178809..73178828 60.24 50
upstream ENSMUSE00000264297 Chr7:73180067..73180154 AGAAGTGCGTGGATGAACCT Chr7:73180103..73180122 59.73 50
upstream ENSMUSE00000264283 Chr7:73183867..73183970 TCAGAGCTCGTCAAATGTGG Chr7:73183919..73183938 59.98 50
upstream ENSMUSE00000264275 Chr7:73188401..73188530 TGGCTTACCCCACAAAGTGT Chr7:73188504..73188523 60.41 50
upstream ENSMUSE00000264267 Chr7:73192443..73192555 GAGGAGAACTGCCTGAGCTG Chr7:73192447..73192466 60.28 60

*** Putative Vector Insertion (Chr 7: 73192556 - 73193791) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000402736 Chr7:73193792..73195220 GTTTCGGAAGGAGCTGACTG Chr7:73194501..73194520 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGGCAGTGCAAGGAGTA Chr7:73192589..73192609 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCACACAGCTGGGAACCT Chr7:73192507..73192527 60.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030513