Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3861
Trapped Gene
Atp6v1a (ENSMUSG00000052459)
Vector Insertion
Chr 16: 44091379 - 44098839
Public Clones AW0666 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000432582 (Chr16:44098840..44099043 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGATCTGGCAGAAATCGTG Chr16:44098855..44098874 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000432582 (Chr16:44098840..44099043 -)
Downstram Exon
ENSMUSE00000432574 (Chr16:44091284..44091378 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGATCTGGCAGAAATCGTG Chr16:44098855..44098874 60.22 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000433259 Chr16:44139075..44139132 GGGTCCCGTCTAGGTACACTT Chr16:44139097..44139117 59.38 57.14
upstream ENSMUSE00000700143 Chr16:44139061..44139309 CTTTTCTGAAGTCGCGGAAC Chr16:44139273..44139292 59.99 50
upstream ENSMUSE00000432662 Chr16:44116900..44116995 GCTACCCAAAATCCGAGATG Chr16:44116948..44116967 59.53 50
upstream ENSMUSE00000717637 Chr16:44116900..44116995 GCTACCCAAAATCCGAGATG Chr16:44116948..44116967 59.53 50
upstream ENSMUSE00000432642 Chr16:44114727..44114855 GTACGAGCTGGTGAGAGTGG Chr16:44114802..44114821 58.46 60
upstream ENSMUSE00000432636 Chr16:44111611..44111825 TACCCAGCAAAAACCTACGG Chr16:44111611..44111630 59.99 50
upstream ENSMUSE00000432629 Chr16:44111208..44111345 GAGGAAGCGTGACTTACATCG Chr16:44111234..44111254 59.89 52.38
upstream ENSMUSE00000432623 Chr16:44109608..44109759 GAGAGTCCTCGATGCCCTTT Chr16:44109612..44109631 60.74 55
upstream ENSMUSE00000432619 Chr16:44107838..44108000 GTCAGAAGTTCTCCGCGACT Chr16:44107846..44107865 59.6 55
upstream ENSMUSE00000432612 Chr16:44107048..44107156 GAAGAGGACAGCGCTGGTAG Chr16:44107099..44107118 60.16 60
upstream ENSMUSE00000432607 Chr16:44101876..44101998 ATTTCCGTGACATGGGCTAC Chr16:44101961..44101980 59.82 50
upstream ENSMUSE00000432597 Chr16:44101678..44101792 TGTCTCGGAAACCCTGAGAG Chr16:44101705..44101724 60.38 55
upstream ENSMUSE00000432592 Chr16:44100055..44100118 ACTTCTGCAACGCTGGGTAT Chr16:44100062..44100081 59.76 50
upstream ENSMUSE00000432582 Chr16:44098840..44099043 AGGATCTGGCAGAAATCGTG Chr16:44098855..44098874 60.22 50

*** Putative Vector Insertion (Chr 16: 44091379 - 44098839) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000432574 Chr16:44091284..44091378 No primer for this exon
downstream ENSMUSE00000432566 Chr16:44089019..44089190 GACAGCATCCCCACTGTCTT Chr16:44089133..44089152 60.12 55
downstream ENSMUSE00000643560 Chr16:44085758..44087629 GCTCTCTGAAGCGAGCCTTA Chr16:44086282..44086301 60 55
downstream ENSMUSE00000700146 Chr16:44085517..44087629 GCTCTCTGAAGCGAGCCTTA Chr16:44086282..44086301 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGATCTGGCAGAAATCGT Chr16:44095854..44095874 59.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGATCTGGCAGAAATCGT Chr16:44095854..44095874 59.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052459