Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38612
Trapped Gene
Ubap2l (ENSMUSG00000042520)
Vector Insertion
Chr 3: 89823073 - 89824992
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306882 (Chr3:89824819..89824991 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTTTGGGTCAGAGCCTGT Chr3:89824900..89824919 60.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306882 (Chr3:89824819..89824991 -)
Downstram Exon
ENSMUSE00000306876 (Chr3:89823074..89823263 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTTTGGGTCAGAGCCTGT Chr3:89824900..89824919 60.3 55 GAATCGGGCCACTCTGATAA Chr3:89823177..89823196 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456125 Chr3:89856312..89856394 TGGAGGAGACTGAGGTAAAGTTG Chr3:89856368..89856390 59.8 47.83
upstream ENSMUSE00000705780 Chr3:89856312..89856377 No primer for this exon
upstream ENSMUSE00000566787 Chr3:89851692..89851821 GGGAACAACCTCAAAACCAA Chr3:89851722..89851741 59.81 45
upstream ENSMUSE00000174539 Chr3:89848776..89848853 GCAAATTCGACTTGCACAGA Chr3:89848823..89848842 59.99 45
upstream ENSMUSE00000174540 Chr3:89847622..89847732 TGTGTGATTGCTTTGCATGA Chr3:89847680..89847699 59.83 40
upstream ENSMUSE00000375404 Chr3:89842770..89842938 CGAGACCGGGACAGAGACTA Chr3:89842829..89842848 60.4 60
upstream ENSMUSE00000566784 Chr3:89842737..89842938 AGCCGTGGACGAGAGTGTAT Chr3:89842766..89842785 59.75 55
upstream ENSMUSE00000352090 Chr3:89842292..89842387 GATTGGATGGCACCAAGAGT Chr3:89842350..89842369 59.93 50
upstream ENSMUSE00000379256 Chr3:89838577..89838622 TAGGCGAGGAGGAAGGTTTT Chr3:89838593..89838612 60.2 50
upstream ENSMUSE00000338869 Chr3:89837987..89838099 CTGGCCACTTTGAACCAGAT Chr3:89837997..89838016 60.11 50
upstream ENSMUSE00000455695 Chr3:89835233..89835292 TCCCCGAAAATTTGAGACTG Chr3:89835239..89835258 60.04 45
upstream ENSMUSE00000358880 Chr3:89835218..89835292 TCCCCGAAAATTTGAGACTG Chr3:89835239..89835258 60.04 45
upstream ENSMUSE00000399600 Chr3:89832247..89832299 CATGGAGGACTGCAACAGAA Chr3:89832277..89832296 59.83 50
upstream ENSMUSE00000371978 Chr3:89830515..89830600 TGTGTCTTCAGTGCCTCTGC Chr3:89830549..89830568 60.19 55
upstream ENSMUSE00000412533 Chr3:89828985..89829156 ACAGCCTGCTTCAGGGAGTA Chr3:89829005..89829024 60.01 55
upstream ENSMUSE00000306899 Chr3:89827353..89827551 CTCTTGGGATATGGGCTCAA Chr3:89827383..89827402 60.03 50
upstream ENSMUSE00000306891 Chr3:89825161..89825438 TTCACCCCATCTTCAACCAT Chr3:89825363..89825382 60.17 45
upstream ENSMUSE00000306882 Chr3:89824819..89824991 CAGTTTGGGTCAGAGCCTGT Chr3:89824900..89824919 60.3 55
upstream ENSMUSE00000306876 Chr3:89823074..89823263 TTATCAGAGTGGCCCGATTC Chr3:89823199..89823218 60.04 50

*** Putative Vector Insertion (Chr 3: 89823073 - 89824992) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306868 Chr3:89822336..89822390 CTTCAACAGATTGCGTGGTC Chr3:89822314..89822333 59.29 50
downstream ENSMUSE00000306861 Chr3:89821037..89821211 ATCTCCTCCGTATGGCTCAA Chr3:89821045..89821064 59.65 50
downstream ENSMUSE00000306853 Chr3:89820621..89820693 TGTTGAAGTACGCCCAGAAG Chr3:89820611..89820630 58.92 50
downstream ENSMUSE00000306843 Chr3:89819224..89819419 GAGCTTCGAGTTGAGGCTGT Chr3:89819219..89819238 59.75 55
downstream ENSMUSE00000306834 Chr3:89819052..89819140 GAAGGTTGGGAGGAGCTTTT Chr3:89819098..89819117 59.69 50
downstream ENSMUSE00000306826 Chr3:89816608..89816661 TGGAAATCTTGTCTGGAGCA Chr3:89816589..89816608 59.37 45
downstream ENSMUSE00000356782 Chr3:89814355..89814436 GTGTGGGAAACGGGATACTG Chr3:89814387..89814406 60.23 55
downstream ENSMUSE00000384171 Chr3:89813032..89813249 TGAGTCTGCGTCTGGTTCTG Chr3:89813137..89813156 60.18 55
downstream ENSMUSE00000306814 Chr3:89812178..89812283 GTAGCCGAGGCATTCACACT Chr3:89812203..89812222 60.28 55
downstream ENSMUSE00000566778 Chr3:89810142..89810539 AATTAGCTCTCAGCCGTCCA Chr3:89810466..89810485 59.98 50
downstream ENSMUSE00000306806 Chr3:89807167..89807234 CCCGTGTTACTGGAGGTGAC Chr3:89807185..89807204 60.42 60
downstream ENSMUSE00000366425 Chr3:89806201..89806398 GCAGGAGTACCGGAATGAAA Chr3:89806336..89806355 60.07 50
downstream ENSMUSE00000705778 Chr3:89806201..89806395 GCAGGAGTACCGGAATGAAA Chr3:89806336..89806355 60.07 50
downstream ENSMUSE00000346982 Chr3:89805740..89805790 CGCTGGCAACAGAGAATCAT Chr3:89805734..89805753 61.35 50
downstream ENSMUSE00000455707 Chr3:89804818..89804913 GATGGAGCTGGTCTGGCTAC Chr3:89804856..89804875 59.83 60
downstream ENSMUSE00000705777 Chr3:89804137..89804175 AGCTGGTCATCGACGAGAGT Chr3:89804125..89804144 60.02 55
downstream ENSMUSE00000390574 Chr3:89804064..89804175 AGCTGGTCATCGACGAGAGT Chr3:89804125..89804144 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCTCTGGCTGTGGAGATG Chr3:89824966..89824986 62.15 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCTCTGGCTGTGGAGATG Chr3:89824966..89824986 62.15 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042520