Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38621
Trapped Gene
Actg1 (ENSMUSG00000062825)
Vector Insertion
Chr 11: 120209277 - 120209412
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000718293 (Chr11:120209283..120209411 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAAGAAATCGCCGCACTC Chr11:120209382..120209401 61.78 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000718293 (Chr11:120209283..120209411 -)
Downstram Exon
ENSMUSE00000642721 (Chr11:120209278..120209405 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAAGAAATCGCCGCACTC Chr11:120209382..120209401 61.78 50 CCTACGATGGAAGGGAACAC Chr11:120209277..120209296 59.4 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514753 Chr11:120209739..120209806 CGGCTTACACTGCGCTTCTT Chr11:120209772..120209791 62.85 55
upstream ENSMUSE00000669070 Chr11:120209739..120209789 GCTTACACTGCGCTTCTTGC Chr11:120209770..120209789 61.25 55
upstream ENSMUSE00000519825 Chr11:120209283..120209411 AAGAAGAAATCGCCGCACTC Chr11:120209382..120209401 61.78 50
upstream ENSMUSE00000653684 Chr11:120209283..120209414 CAGATCGCAATGGAAGAAGA Chr11:120209395..120209414 58.95 45
upstream ENSMUSE00000718293 Chr11:120209283..120209411 AAGAAGAAATCGCCGCACTC Chr11:120209382..120209401 61.78 50
upstream ENSMUSE00000642721 Chr11:120209278..120209405 AAGAAGAAATCGCCGCACTC Chr11:120209382..120209401 61.78 50

*** Putative Vector Insertion (Chr 11: 120209277 - 120209412) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000669069 Chr11:120209177..120209189 No primer for this exon
downstream ENSMUSE00000518917 Chr11:120208950..120209189 CTTCTCCATGTCGTCCCAGT Chr11:120209039..120209058 60.11 55
downstream ENSMUSE00000643764 Chr11:120208950..120209193 CTTCTCCATGTCGTCCCAGT Chr11:120209039..120209058 60.11 55
downstream ENSMUSE00000504477 Chr11:120208225..120208663 AGGGCGTAGCCCTCATAGAT Chr11:120208493..120208512 60.08 55
downstream ENSMUSE00000575014 Chr11:120207951..120208132 GTGCTAGGGCTGTGATCTCC Chr11:120207949..120207968 59.83 60
downstream ENSMUSE00000480921 Chr11:120207740..120207847 ACAGTGAGGCCAGAATGGAG Chr11:120207762..120207781 60.26 55
downstream ENSMUSE00000643758 Chr11:120207664..120207738 TAGAAGCATTTGCGGTGGAC Chr11:120207683..120207702 61.17 50
downstream ENSMUSE00000469694 Chr11:120207005..120207847 AGGCAACTAACAACCGATGG Chr11:120207159..120207178 59.99 50
downstream ENSMUSE00000488442 Chr11:120207004..120207847 AGGCAACTAACAACCGATGG Chr11:120207159..120207178 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCAATGGAAGAAGAAATCG Chr11:120209388..120209408 60.71 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCAATGGAAGAAGAAATCG Chr11:120209388..120209408 60.71 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062825