Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38623
Trapped Gene
Dnajb12 (ENSMUSG00000020109)
Vector Insertion
Chr 10: 59342559 - 59352775
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000332776 (Chr10:59342374..59342558 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATGGAATCCAACAAGGAT Chr10:59342424..59342443 59.6 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000332776 (Chr10:59342374..59342558 +)
Downstram Exon
ENSMUSE00000290744 (Chr10:59352776..59352956 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATGGAATCCAACAAGGAT Chr10:59342424..59342443 59.6 45 GTCTGTGGGTTGAGGGTGAT Chr10:59352840..59352859 59.82 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000332776 Chr10:59342374..59342558 CCATGGAATCCAACAAGGAT Chr10:59342424..59342443 59.6 45

*** Putative Vector Insertion (Chr 10: 59342559 - 59352775) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000290744 Chr10:59352776..59352956 GTCTGTGGGTTGAGGGTGAT Chr10:59352840..59352859 59.82 55
downstream ENSMUSE00000290738 Chr10:59353588..59353733 GCACTTCTGCTTACCCCAAG Chr10:59353641..59353660 59.88 55
downstream ENSMUSE00000100711 Chr10:59355420..59355605 GGAGATGTCAGCCTCAAAGC Chr10:59355562..59355581 59.96 55
downstream ENSMUSE00000290719 Chr10:59355686..59355765 GCTGGTAGGTGTACCGCATT Chr10:59355736..59355755 60.02 55
downstream ENSMUSE00000290710 Chr10:59356979..59357088 CAGCTGCACGAACACTCCTA Chr10:59357008..59357027 60.2 55
downstream ENSMUSE00000290705 Chr10:59358336..59358508 GTCAGTGACTCGCTTGTGGA Chr10:59358372..59358391 60.03 55
downstream ENSMUSE00000405815 Chr10:59359098..59359243 GTGCCCATCTTCTGTGCTCT Chr10:59359173..59359192 60.42 55
downstream ENSMUSE00000517070 Chr10:59360239..59361269 ACTTTCGTTGCCATGGTTTC Chr10:59360511..59360530 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGGGGACTCCTAGAAAGGT Chr10:59342557..59342578 59.95 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGGGGACTCCTAGAAAGGT Chr10:59342557..59342578 59.95 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020109