Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38638
Trapped Gene
Zfp628 (ENSMUSG00000074406)
Vector Insertion
Chr 7: 4869119 - 4870403
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000705974 (Chr7:4869012..4869118 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTGGTCACAGAAGGGAGA Chr7:4869039..4869058 59.68 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000705974 (Chr7:4869012..4869118 +)
Downstram Exon
ENSMUSE00000637495 (Chr7:4870404..4871195 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTGGTCACAGAAGGGAGA Chr7:4869039..4869058 59.68 55 TTTATAGGGCCGTTCACCTG Chr7:4870574..4870593 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000705975 Chr7:4866819..4867007 No primer for this exon
upstream ENSMUSE00000705974 Chr7:4869012..4869118 AGGTGGTCACAGAAGGGAGA Chr7:4869039..4869058 59.68 55

*** Putative Vector Insertion (Chr 7: 4869119 - 4870403) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000705973 Chr7:4870378..4873604 AGTTGTACCGTGGCCACTTC Chr7:4872856..4872875 60.03 55
downstream ENSMUSE00000637495 Chr7:4870404..4871195 TTTATAGGGCCGTTCACCTG Chr7:4870574..4870593 59.95 50
downstream ENSMUSE00000637494 Chr7:4871407..4871415 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000074406