Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3864
Trapped Gene
C330007P06Rik (ENSMUSG00000006423)
Vector Insertion
Chr X: 34391158 - 34392633
Public Clones AW0613 (sanger) RRM015 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000465849 (ChrX:34392634..34392726 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000465849 (ChrX:34392634..34392726 -)
Downstram Exon
ENSMUSE00000702160 (ChrX:34389114..34391157 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000316375 ChrX:34414030..34414106 No primer for this exon
upstream ENSMUSE00000206175 ChrX:34404004..34404154 No primer for this exon
upstream ENSMUSE00000316370 ChrX:34404004..34404298 No primer for this exon
upstream ENSMUSE00000206173 ChrX:34403619..34403736 No primer for this exon
upstream ENSMUSE00000206177 ChrX:34396847..34396888 No primer for this exon
upstream ENSMUSE00000206171 ChrX:34394278..34394416 No primer for this exon
upstream ENSMUSE00000206174 ChrX:34393325..34393414 No primer for this exon
upstream ENSMUSE00000465849 ChrX:34392634..34392726 No primer for this exon

*** Putative Vector Insertion (Chr X: 34391158 - 34392633) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702160 ChrX:34389114..34391157 No primer for this exon
downstream ENSMUSE00000363469 ChrX:34388545..34391157 No primer for this exon
downstream ENSMUSE00000702162 ChrX:34368231..34368237 No primer for this exon
downstream ENSMUSE00000702161 ChrX:34364087..34364164 No primer for this exon
downstream ENSMUSE00000337216 ChrX:34364025..34364164 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCTGCAGGAGTTGGTAAG ChrX:34392627..34392647 59.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCTGCAGGAGTTGGTAAG ChrX:34392627..34392647 59.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006423