Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38653
Trapped Gene
Nr1h2 (ENSMUSG00000060601)
Vector Insertion
Chr 7: 51808948 - 51809294
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000595347 (Chr7:51809179..51809293 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCTACTCCCAGGCTTCTG Chr7:51809230..51809249 59.19 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000595347 (Chr7:51809179..51809293 -)
Downstram Exon
ENSMUSE00000595346 (Chr7:51808949..51809078 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCTACTCCCAGGCTTCTG Chr7:51809230..51809249 59.19 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000595347 Chr7:51809179..51809293 GAGCTACTCCCAGGCTTCTG Chr7:51809230..51809249 59.19 60
upstream ENSMUSE00000674806 Chr7:51809179..51809318 CGGAAGAAGTGGCGAAGTTA Chr7:51809284..51809303 60.38 50
upstream ENSMUSE00000595346 Chr7:51808949..51809078 GTTTCCAGGGCAACAGAGTC Chr7:51809041..51809060 59.7 55
upstream ENSMUSE00000674805 Chr7:51808949..51809056 No primer for this exon

*** Putative Vector Insertion (Chr 7: 51808948 - 51809294) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000595345 Chr7:51808067..51808124 CATAGTGGGTCACGAAGCAG Chr7:51808082..51808101 59.31 55
downstream ENSMUSE00000674804 Chr7:51808067..51808127 CATAGTGGGTCACGAAGCAG Chr7:51808082..51808101 59.31 55
downstream ENSMUSE00000708895 Chr7:51808067..51808124 CATAGTGGGTCACGAAGCAG Chr7:51808082..51808101 59.31 55
downstream ENSMUSE00000595344 Chr7:51807877..51807990 CAGAGCTGGACCCTTCAGAG Chr7:51807867..51807886 60.13 60
downstream ENSMUSE00000595343 Chr7:51807325..51807615 GCTGAGCACGTTGTAGTGGA Chr7:51807466..51807485 60.06 55
downstream ENSMUSE00000674802 Chr7:51807325..51807606 GCTGAGCACGTTGTAGTGGA Chr7:51807466..51807485 60.06 55
downstream ENSMUSE00000467605 Chr7:51806970..51807229 TTCTTCCGAATCTGCTCCTC Chr7:51807177..51807196 59.51 50
downstream ENSMUSE00000532492 Chr7:51806688..51806867 ATGGCTAGCTCGGTGAAGTG Chr7:51806769..51806788 60.42 55
downstream ENSMUSE00000465621 Chr7:51806115..51806214 TCTCGTGGTTGTAGCGTCTG Chr7:51806153..51806172 60.05 55
downstream ENSMUSE00000464617 Chr7:51805670..51805878 TGTTGATGGCGATAAGCAAG Chr7:51805755..51805774 59.83 45
downstream ENSMUSE00000674801 Chr7:51805005..51805501 CAAGGTGCATGGTGTGGTAG Chr7:51805074..51805093 60.03 55
downstream ENSMUSE00000471235 Chr7:51804987..51805501 CAAGGTGCATGGTGTGGTAG Chr7:51805074..51805093 60.03 55
downstream ENSMUSE00000674803 Chr7:51804986..51805501 CAAGGTGCATGGTGTGGTAG Chr7:51805074..51805093 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTGCTTCGAGCTTAATCG Chr7:51809237..51809257 59.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGCTTCGAGCTCGTGACT Chr7:51809236..51809256 60.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060601