Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38666
Trapped Gene
Jazf1 (ENSMUSG00000063568)
Vector Insertion
Chr 6: 52843992 - 53018590
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000561364 (Chr6:53018447..53018589 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGATGTAGCACCATGACAGG Chr6:53018554..53018573 60.14 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000561364 (Chr6:53018447..53018589 -)
Downstram Exon
ENSMUSE00000498105 (Chr6:52843993..52844065 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGATGTAGCACCATGACAGG Chr6:53018554..53018573 60.14 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561364 Chr6:53018447..53018589 CGATGTAGCACCATGACAGG Chr6:53018554..53018573 60.14 55
upstream ENSMUSE00000498105 Chr6:52843993..52844065 TGTGGCCCTCAGTTACATCA Chr6:52843997..52844016 60.11 50

*** Putative Vector Insertion (Chr 6: 52843992 - 53018590) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000373459 Chr6:52762097..52762293 CACTGCTATGTCGAGGTGGA Chr6:52762144..52762163 59.85 55
downstream ENSMUSE00000398052 Chr6:52727529..52727698 ACATGGAGCTGAGGATTGCT Chr6:52727572..52727591 59.83 50
downstream ENSMUSE00000616922 Chr6:52718791..52720374 GCGTATTAGGCAACCGGTAA Chr6:52718840..52718859 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTCTAATGAATGCAGGTGA Chr6:52916595..52916616 59.95 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAACGTGACTGGGAAAACC Chr6:52931523..52931544 60.39 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063568