Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38667
Trapped Gene
Plvap (ENSMUSG00000034845)
Vector Insertion
Chr 8: 74030569 - 74030818
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000330885 (Chr8:74030736..74030817 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCCTGTAGTCAACCCTGCT Chr8:74030747..74030766 59.72 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000330885 (Chr8:74030736..74030817 -)
Downstram Exon
ENSMUSE00000682485 (Chr8:74030570..74030573 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCCTGTAGTCAACCCTGCT Chr8:74030747..74030766 59.72 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000330923 Chr8:74035250..74035651 TCGTGTCGCTCATTCAGTTC Chr8:74035508..74035527 59.99 50
upstream ENSMUSE00000330913 Chr8:74032363..74032459 CAGGAACAGCTGAAGGAGGT Chr8:74032380..74032399 59.45 55
upstream ENSMUSE00000330904 Chr8:74031500..74032206 ACCCGTGAGAATGCAGAACT Chr8:74031768..74031787 59.73 50
upstream ENSMUSE00000330894 Chr8:74030919..74030976 No primer for this exon
upstream ENSMUSE00000330885 Chr8:74030736..74030817 TCCCTGTAGTCAACCCTGCT Chr8:74030747..74030766 59.72 55
upstream ENSMUSE00000682485 Chr8:74030570..74030573 No primer for this exon

*** Putative Vector Insertion (Chr 8: 74030569 - 74030818) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000395537 Chr8:74021666..74022304 CCGGAACGCTCATCTACAAT Chr8:74021729..74021748 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTAGCCTGGAGGAATTCAA Chr8:74030791..74030811 59.41 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTAGCCTGGAGGAATTCAAG Chr8:74030790..74030811 60.35 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034845