Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38678
Trapped Gene
AL845476.15-202 (ENSMUSG00000078887)
Vector Insertion
Chr 2: 175872236 - 175877360
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678774 (Chr2:175872181..175872235 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGATGCTGTGAATTTAGC Chr2:175872188..175872208 59.87 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678774 (Chr2:175872181..175872235 +)
Downstram Exon
ENSMUSE00000638781 (Chr2:175877361..175877487 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGATGCTGTGAATTTAGC Chr2:175872188..175872208 59.87 47.62 CACCTGCACGTCATCATAGG Chr2:175877393..175877412 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678775 Chr2:175868351..175868513 GGACCAGCCAGTCAGAAGAG Chr2:175868357..175868376 59.99 60
upstream ENSMUSE00000678774 Chr2:175872181..175872235 GCTGGATGCTGTGAATTTAGC Chr2:175872188..175872208 59.87 47.62

*** Putative Vector Insertion (Chr 2: 175872236 - 175877360) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638781 Chr2:175877361..175877487 CACCTGCACGTCATCATAGG Chr2:175877393..175877412 60.14 55
downstream ENSMUSE00000638780 Chr2:175877689..175877749 No primer for this exon
downstream ENSMUSE00000678770 Chr2:175877689..175878788 GTTGGTAAATGTCCCCAGGA Chr2:175878489..175878508 59.65 50
downstream ENSMUSE00000678771 Chr2:175878907..175880380 GGTTTCGCTCCTGAATGTGT Chr2:175880283..175880302 60.12 50
downstream ENSMUSE00000678772 Chr2:175884123..175884150 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTCCCACAAAGAGGAGGA Chr2:175875251..175875271 59.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCCCACAAAGAGGAGGA Chr2:175875251..175875271 59.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078887