Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI38688
Trapped Gene
Zfp120 (ENSMUSG00000068134)
Vector Insertion
Chr 2: 149945560 - 149962411
Public Clones (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706166 (Chr2:149962304..149962410 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706166 (Chr2:149962304..149962410 -)
Downstram Exon
ENSMUSE00000556893 (Chr2:149945561..149945687 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479677 Chr2:149962304..149962414 No primer for this exon
upstream ENSMUSE00000706166 Chr2:149962304..149962410 No primer for this exon
upstream ENSMUSE00000556893 Chr2:149945561..149945687 No primer for this exon

*** Putative Vector Insertion (Chr 2: 149945560 - 149962411) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000556890 Chr2:149945301..149945364 No primer for this exon
downstream ENSMUSE00000476135 Chr2:149943800..149943936 No primer for this exon
downstream ENSMUSE00000538884 Chr2:149942892..149943797 No primer for this exon
downstream ENSMUSE00000556889 Chr2:149941959..149943936 No primer for this exon
downstream ENSMUSE00000682140 Chr2:149940142..149943936 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATGTTAATCGCCTTGCAG Chr2:149956346..149956366 59.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCGTGACTGGGAAAACC Chr2:149956344..149956364 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068134